Dataset Information

Comprehensive protein profiling reveals pleiotropic effects of Bemisia tabaci and Tomato Mottle Virus infection on local and systemic tomato leaves

ABSTRACT: Tomato seeds (S. lycopersicum ‘Fl Lanai’) were germinated under greenhouse conditions maintained at 24°C-29°C in flat trays (BWI Apopka, Catalog Number GPPF72S7X) filled with Sungro Horticulture soil (Metro-mix 830, BWI Apopka, Cat# TX830). Two weeks post emergence seedlings were transplanted to 4” pots using the same soil and transferred to a Conviron walk-in growth chamber (CMP6060) for the remainder of the experiment. Conviron conditions include a 14h/10h light/dark cycle maintained at 28°C, and plants were fertilized weekly (20-20-20). To prevent cross contamination, tomato plants were confined to insect proof cages at all times (BioQuip 1450NS68). Four weeks after transplanting, 40 whiteflies (B. tabaci MEAM1) were collected from virus free or Tomato Mottle Virus (ToMoV) established colonies via aspiration and moved into a clip cage placed on the 4th true leaf of each tomato plant as previously described38. Whiteflies were reared cabbage (Brassica oleracea), while viruliferous whiteflies were reared on ToMoV infected tomato from colonies established in the Polston lab. For all plants in this study, feeding was halted after 3 days of whitefly feeding (3 DPI) by gentle removal of clip cages and whitefly termination using insecticidal soap (Garden Safe, 1% of potassium salts of fatty acids). For the samples referred to as “local”, the tomato leaf bound within the clip cages was immediately removed and snap frozen for protein extraction. For the samples designated “systemic”, the plants were allowed to continue growing for 7 additional days after clip cage removal and whitefly termination, at which point the 9th leaf was excised and snap frozen. Plants used for collection of local leaves at 3 DPI were not used for the collection of systemic leaves 10 DPI. For both local and systemic leaves collected, we also included a no treatment control (NTC) that was subjected identically to clip cage and insecticidal soap applications, but without the addition of whitefly or ToMoV. Our experiment therefore consists of a no-treatment control (NTC), a whitefly treatment (+WF), and a viruliferous whitefly (+WFV) treatment for both local (4th true leaf, 3 DPI) and systemic leaves (9th true leaf, 10 DPI). The presence of ToMoV in all infected plants was confirmed via Nanopore sequencing. Briefly, Tomato genomic DNA was extracted from five systemic leaf samples using the PureGene tissue DNA isolation kit (product # 158667; QIAGEN, Valencia, CA, USA), following the manufacturer’s protocol and stored at -80°C until needed. Library preparation was performed using the Rapid Sequencing Kit RBK004 protocol (Oxford Nanopore Technologies) and loaded onto a 9.4.1 flow cell in a MinION connected to a MinIT with live base calling enabled. Resulting sequencing reads for each sample were mapped to both ToMoV A component (GenBank accession: L14460) and ToMoV B component (GenBank accession: L14461) sequences.

INSTRUMENT(S): LTQ Orbitrap Velos

ORGANISM(S): Tomato Mottle Virus Solanum Lycopersicum

TISSUE(S): Plant Cell, Leaf

SUBMITTER: Aaron Ogden

LAB HEAD: Joshua Adkins

PROVIDER: PXD019197 | Pride | 2020-10-02

REPOSITORIES: Pride

ACCESS DATA

Similar Datasets

Project description:Aphid attack induces defense responses in plants activating several signaling cascades that led to the production of toxic, repellent or antinutritive compounds and the consequent reorganization of the plant primary metabolism. Pepper (Capsicum annuum L.) leaf proteomic response against Myzus persicae (Sulzer) has been investigated and analyzed by LC-MS/MS coupled with bioinformatics tools. Infestation with an initially low density (20 aphids/plant) of aphids restricted to a single leaf taking advantage of clip cages resulted in 6 differentially expressed proteins relative to control leaves (3 proteins at 2 days post-infestation and 3 proteins at 4 days post-infestation). Conversely, when plants were infested with a high density of infestation (200 aphids/plant) 140 proteins resulted differentially expressed relative to control leaves (97 proteins at 2 days post-infestation, 112 proteins at 4 days post-infestation and 105 proteins at 7 days post-infestation). The majority of proteins altered by aphid attack were involved in photosynthesis and photorespiration, oxidative stress, translation, protein folding and degradation and amino acid metabolism. Other proteins identified were involved in lipid, carbohydrate and hormone metabolism, transcription, transport, energy production and cell organization. However proteins directly involved in defense were scarce and were mostly downregulated in response to aphids. The unexpectedly very low number of regulated proteins found in the experiment with a low aphid density suggests an active mitigation of plant defensive response by aphids or alternatively an aphid strategy to remain undetected by the plant. Under a high density of aphids, pepper leaf proteome however changed significantly revealing nearly all routes of plant primary metabolism being altered. Photosynthesis was so far the process with the highest number of proteins being regulated by the presence of aphids. In general, at short times of infestation (2 days) most of the altered proteins were upregulated. However, at longer times of infestation (7 days) the protein downregulation prevailed. Proteins involved in plant defense and in hormone signaling were scarce and mostly downregulated.

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Project description:Tomato curly stunt virus (ToCSV) is a monopartite begomovirus infecting tomatoes in South Africa, with sequence similarity to tomato yellow leaf curl virus (TYLCV). While there are numerous reports on the mechanism of TYLCV resistance in tomato, the underlying mechanisms in the tomato-ToCSV pathosystem is still relatively unknown. The main aim of this study was to investigate and compare the global methylation profile of ToCSV in two near-isogenic tomato lines, one with a tolerant phenotype (T, NIL396) and one with a susceptible phenotype (S, NIL395). Bisulfite conversion and PCR amplification, coupled with a next-generation sequencing approach, were used to elucidate the global pattern of methylation of ToCSV cytosine residues in T and S leave tissue at 35 days post-infection (dpi). The extent of methylation was more pronounced in tolerant plants compared to susceptible plants in all sequence (CG, CHG and CHH) contexts, however, the overall methylation levels were relatively low (<3%). Notably, a significant interaction (p < 0.05) was observed between the viral genomic region and susceptible vs. tolerant status for CG methylated regions where it was observed that the 3'IR CG methylation was significantly (p < 0.05) higher than CG methylation of other genomic regions in tolerant and susceptible plants. Additionally, statistically significant (EdgeR p < 0.05) differentially methylated cytosines were located primarily in the genomic regions V2/V1 and C4/C1 of ToCSV. The relative expression, using RT-qPCR, was also employed in order to quantify the expression of various key methylation-related genes, MET1, CMT2, KYP4/SUVH4, DML2, RDM1, AGO4 and AGO6 in T vs. S plants at 35dpi. The differential expression between T and S was significant for MET1, KYP4/SUVH4 and RDM1 at p<0.05 which further supports more pronounced methylation observed in ToCSV from T plants vs. S plants. While this study provides new insights into the differences in methylation profiles of ToCSV in S vs. T tomato plants, further research is required to link tolerance and susceptibility to ToCSV.

Dataset Information

Comprehensive protein profiling reveals pleiotropic effects of Bemisia tabaci and Tomato Mottle Virus infection on local and systemic tomato leaves

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure