Small RNA libraries from pooled synthetic miRNAs
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE94912 | GEO | 2017/02/16
SECONDARY ACCESSION(S): PRJNA374802
REPOSITORIES: GEO
Similar Datasets
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-21 | GSE113491 | GEO
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-09 | GSE112871 | GEO
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs (15~50 nt) in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-21 | GSE113490 | GEO
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs (15~50 nt) in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-09 | GSE112870 | GEO
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies,<br><br>Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).
2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress
Project description:Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification.
2009-09-08 | GSE14511 | GEO
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis.<br><br>Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification<br><br>of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II<br><br>reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)
2011-08-31 | E-MEXP-3213 | biostudies-arrayexpress
Project description:To investigate the role of smoking in the rupture of intracranial aneurysms (IA), plasma miRNA profiles of smoking IA patients, non-smoking IA patients, and healthy volunteers were analyzed.
2023-11-15 | GSE231922 | GEO
Project description:Chemical methods have enabled the total synthesis of protein molecules of ever-increasing size and complexity. However, methods to engineer synthetic proteins comprising noncanonical amino acids have not kept pace, even though this capability would be a distinct advantage of the total synthesis approach to protein science. In this work, we report a platform for protein engineering based on the screening of synthetic one-bead one-compound protein libraries. Screening throughput approaching that of cell surface display was achieved by a combination of magnetic bead enrichment, flow cytometry analysis of on-bead screens, and high-throughput MS/MS-based sequencing of identified active compounds. Direct screening of a synthetic protein library by these methods resulted in the de novo discovery of mirror-image miniprotein-based binders to a ∼150-kDa protein target, a task that would be difficult or impossible by other means.
| S-EPMC6003312 | biostudies-literature
Project description:Pooled CRISPR libraries are widely used in high-throughput screening to study various biological processes. Various pooled CRISPR libraries have been shared for CRISPR screens and useful tools have been developed to construct researcher's own libraries, however, many researchers are struggling to create their own pooled CRISPR libraries: it is a time-consuming, labor-intensive, and expensive process. In this study, we develop a simple method to customize conventional pooled CRISPR libraries using the CRISPR/Cas9 system. We show that conventional pooled CRISPR libraries can be modified by eliminating gRNAs that target positive genes, enabling the identification of unknown target genes in CRISPR screening. CRISPR/Cas9 system can be applied as a precise tool for customizing conventional pooled CRISPR libraries and will broaden the scope of high-throughput screening technology.
| S-EPMC6010251 | biostudies-literature