GIM musmusculus anti-Dicer RNAi silencing

ABSTRACT: We used the TriFectaTM (IDT, Integrated DNA Technologies,

Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).

ORGANISM(S): Mus musculus

SUBMITTER: Geraldo Passos 

PROVIDER: E-MEXP-3211 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress