GNPS Streptonigrin analogs
Ontology highlight
ABSTRACT:
INSTRUMENT(S): QSTAR Elite
ORGANISM(S): Streptomyces Flocculus (ncbitaxon:67300)
SUBMITTER: Balunas
PROVIDER: MSV000079113 | GNPS | Fri Apr 24 05:53:00 BST 2015
REPOSITORIES: GNPS
Similar Datasets
Project description:HUVECs were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in an Endothelial Cell Medium (Invitrogen, Carlsbad, CA, USA) containing 5% fetal bovine serum at 37°C in a 5% CO2 incubator. Cells were treated with 30 mM glucose and 0.1 mM palmitic acid (P0500, Sigma-Aldrich, USA) dissolved in 0.5% bovine serum albumin (BSA) for 48 h to simulate HGHF treatment. The Akt inhibitor MK-2206 2HCl was purchased from Selleck Chemicals (S1078, Houston, TX, USA).
2022-08-12 | PXD033227 | Pride
Project description:For the MALDI-MSI experiment, we selected 12 different drugs. The drugs were purchased from the LC Laboratories (Woburn, MA; CAS numbers: dabrafenib: 1195765-45-7, dasatinib: 302962-49-8, erlotinib: 183321-74-6, gefitinib: 184475-35-2, imatinib: 152459-95-5, lapatinib: 388082-78-8, pazopanib: 444731-52-6, sorafenib: 284461-73-0, sunitinib: 557795-19-4, trametinib: 871700-17-3, vatalanib: 212141-54-3) and from SelleckChem (Munich, Germany; CAS numbers: ipratropium: 60205-81-4) with >99% purity and were dissolved in methanol (MeOH, (Chromasolv Plus for HPLC) (Sigma-Aldrich, Steinheim, Germany) at 10 mg/mL concentration. These stock solutions were further diluted with 50% MeOH and five mixtures were generated, each containing four different drug compounds. The spreadsheet in Supporting Information summarizes the composition of the five drug mixtures. A 5 mg/mL solution of α-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich) dissolved in 50% MeOH containing 0.1% trifluoroacetic acid (TFA, Sigma-Aldrich, Steinheim, Germany) was used as matrix solution.
2019-11-06 | PXD016146 | Pride
Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.
2017-11-01 | GSE85242 | GEO
Project description:The high-throughput sequencing technology was performed after the treatment of human ovarian cancer cells A2780 with TMPyP4 and H2O2 purchased from Sigma-Aldrich, to explore the expression of genes related to cell proliferation, DNA damage and ROS levels of ovarian cancer cells A2780 after the treatment of TMPyP4 and H2O2, and to find an interesting target pathway,HIF-1 signaling pathway.
2024-03-25 | GSE262015 | GEO
Project description:ECM is the physicochemical support for the cells living in the tissue microenvironment. it is important to know the protein contents within the ECM that are critical for extra- and intracellular signaling, cell growth, migration, cell-cell/ECM interactions. The ECM gel derived from the Engelbreth-Holm-Swarm murine sarcoma (commonly known as Matrigel or lrECM) purchased from the Sigma Aldrich in the liquid concentration of 8-12 mg/ml (Lot # 064M4075V) was used for the LC-MS/MS analysis and to prepare the 3D scaffolds used for downstream experiments. The Matrigel mass spectrometry data will be used to compare with those of the decellularized mice mammary tissue ECM/DBT-TMS.
2018-10-26 | PXD005696 | Pride
Project description:The transcriptomic changes induced in the human liver cell line HepG2 by Azathriopine (250µM, Sigma-Aldrich), Furan (2mM, Sigma-Aldrich), Tetradecanoyl phorbol acetate (500nM, Sigma-Aldrich), Tetrachloroethylene (2mM, Sigma-Aldrich), Diazinon (250µM, Sigma-Aldrich) and Dmannitol (250µM, Sigma-Aldrich) during 4, 8, 24, 48 and 72hrs As a solvent control for Azathriopine, Furan, Diazinon and Tetradecanoyl phorbol acetate, DMSO was used (0.5%); As a solvent control for tetrachloroethylene, ethanol was used (0.5%); As a solvent control for D-mannitol, HBSS was used (0.5%)
2015-01-13 | GSE58235 | GEO
Project description:We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. R940406 (R406, the active metabolite of fostamatinib) was supplied by Rigel Pharmaceuticals, Inc., South San Francisco, CA, and AstraZeneca Pharmaceuticals, Wilmington, DE, USA. R406 was resuspended in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) and stored at −80°C. . HL-60, U937 and KG-1 cell lines were purchased from the American Type Culture Collection. MOLM-14 cell lines were provided by Dr. Scott Amstrong (Dana-Farber Cancer Institute, Boston MA, USA.) All cell lines were maintained in RPMI 1640 (Cellgro) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS, Sigma-Aldrich) at 37 °C with 5% CO2.
2013-04-24 | GSE46302 | GEO
Project description:Purpose: Identify new targets in EVI1-Positive Acute Myeloid Leukemia Methods: Treatment with cyclocreatine of EVI1-driven AML cell lines TF-1, UT-7 and UCSD-AML1. Cyclocreatine was purchased from Sigma-Aldrich (Sigma). TF-1, UT-7 and UCSD-AML1 cells were treated in quadruplicate with either vehicle or 3 mM cyclocreatine for 24 hours. Total RNA was extracted and profiled by RNA sequencing (HiSeq, Illumina) at BioMicroCenter from Massachusetts Institute of Technology (Cambridge, MA, USA). Results: Alteration of arginine-creatine metabolism by the small-molecule cyclocreatine selectively decreased the viability, promoted cell cycle arrest and apoptosis of EVI1-positive AML cells. Conclusions: Targeting CKMT1 is a promising therapeutic strategy for the EVI1-driven AML subtype that is highly resistant to current treatment regimens.
2017-02-13 | GSE86151 | GEO
Project description:FVB, Balb/c, and C57BL/6 mice received the tobacco carcinogens urethane (Sigma Aldrich, U2500) intraperitoneally (1g/Kg in 100 μl phosphate-buffered saline) or diethylnitrosamine (200 mg/kg) (Sigma Aldrich, N0756). Carcinogen induced lung adenocarcinoma murine cell lines generation| Ten months post first carcinogen (urethane, DEN) exposure mice were sacrificed, lung tumours were dissected from surrounding healthy lung parenchyma under sterile conditions, were halved, one half was processed for histology and the other half was chopped into 1 mm pieces and seeded to cell culture dishes. Cells were cultured under standard conditions outlined below. When adenocarcinoma was diagnosed for a given tumour, its corresponding culture was passaged in vitro over a period of 18 months and 60 passages, whichever occurred first. After gene expression and mutational signature extraction, the signature were compared with human lung adenocarcinoma RNAseq results.
2022-10-24 | GSE126119 | GEO
Project description:Cells were grown to saturation in YPD (YEP + 2% glucose) for 24 hours, diluted into YPA (YEP + 2% potassium acetate) at OD600= 0.3 and grown over night at 30C. Cells were washed with sterilized water the next day and re-suspended in SPII medium (0.3% potassium acetate, pH = 7.0) at OD600= 1.9 to induce sporulation. Cells were sporulated at room temperature or 30C as indicated. Sporulation medium containing benomyl was always prepared freshly on the day of the experiment following the directions in {Shonn, 2000 #90}. Briefly, DMSO (dimethyl sulfoxide, Sigma-Aldrich) or benomyl [Methyl 1-(butylcarbamoyl)-2-benzimidazolecarbamate, Sigma-Aldrich; 30 mg/ml stock in DMSO] was dissolved in near-boiling SPII medium to avoid precipitation. The medium was then allowed to slowly cool to 30C or room temperature. At the time of drug treatment, cells were filtered and immediately re-suspended in the medium containing benomyl or DMSO. Keywords = benomyl sporulation saccharomyces microtubule spindle checkpoint Keywords: ordered
2004-10-18 | GSE1693 | GEO