Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GNPS Streptonigrin analogs

ABSTRACT: Two samples were run: (1) purchased streptonigrin from Sigma Aldrich (2) an extract (pH adjusted to 6.5) made from a culture of S. flocculus (known producer of streptonigrin)

INSTRUMENT(S): QSTAR Elite

ORGANISM(S): Streptomyces Flocculus (ncbitaxon:67300)

SUBMITTER: Balunas

PROVIDER: MSV000079113 | GNPS | Fri Apr 24 05:53:00 BST 2015

REPOSITORIES: GNPS

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

AKT/PACS2 participates in renal vascular hyperpermeability by regulating endothelial fatty acid oxidation in diabetic mice

Project description:HUVECs were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in an Endothelial Cell Medium (Invitrogen, Carlsbad, CA, USA) containing 5% fetal bovine serum at 37°C in a 5% CO2 incubator. Cells were treated with 30 mM glucose and 0.1 mM palmitic acid (P0500, Sigma-Aldrich, USA) dissolved in 0.5% bovine serum albumin (BSA) for 48 h to simulate HGHF treatment. The Akt inhibitor MK-2206 2HCl was purchased from Selleck Chemicals (S1078, Houston, TX, USA).

2022-08-12 | PXD033227 | Pride

MALDI rat liver anticancer drug spiked-in dataset (imzML)

Project description:For the MALDI-MSI experiment, we selected 12 different drugs. The drugs were purchased from the LC Laboratories (Woburn, MA; CAS numbers: dabrafenib: 1195765-45-7, dasatinib: 302962-49-8, erlotinib: 183321-74-6, gefitinib: 184475-35-2, imatinib: 152459-95-5, lapatinib: 388082-78-8, pazopanib: 444731-52-6, sorafenib: 284461-73-0, sunitinib: 557795-19-4, trametinib: 871700-17-3, vatalanib: 212141-54-3) and from SelleckChem (Munich, Germany; CAS numbers: ipratropium: 60205-81-4) with >99% purity and were dissolved in methanol (MeOH, (Chromasolv Plus for HPLC) (Sigma-Aldrich, Steinheim, Germany) at 10 mg/mL concentration. These stock solutions were further diluted with 50% MeOH and five mixtures were generated, each containing four different drug compounds. The spreadsheet in Supporting Information summarizes the composition of the five drug mixtures. A 5 mg/mL solution of α-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich) dissolved in 50% MeOH containing 0.1% trifluoroacetic acid (TFA, Sigma-Aldrich, Steinheim, Germany) was used as matrix solution.

2019-11-06 | PXD016146 | Pride

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

High-throughout sequencing of ovarian cancer cells treated with TMPyP4 and H2O2

Project description:The high-throughput sequencing technology was performed after the treatment of human ovarian cancer cells A2780 with TMPyP4 and H2O2 purchased from Sigma-Aldrich, to explore the expression of genes related to cell proliferation, DNA damage and ROS levels of ovarian cancer cells A2780 after the treatment of TMPyP4 and H2O2, and to find an interesting target pathway,HIF-1 signaling pathway.

2024-03-25 | GSE262015 | GEO

Proteomics of Matrigel, LC-MS/MS

Project description:ECM is the physicochemical support for the cells living in the tissue microenvironment. it is important to know the protein contents within the ECM that are critical for extra- and intracellular signaling, cell growth, migration, cell-cell/ECM interactions. The ECM gel derived from the Engelbreth-Holm-Swarm murine sarcoma (commonly known as Matrigel or lrECM) purchased from the Sigma Aldrich in the liquid concentration of 8-12 mg/ml (Lot # 064M4075V) was used for the LC-MS/MS analysis and to prepare the 3D scaffolds used for downstream experiments. The Matrigel mass spectrometry data will be used to compare with those of the decellularized mice mammary tissue ECM/DBT-TMS.

2018-10-26 | PXD005696 | Pride

Expression Profiles of HepG2 cells treated with following compounds: Azathriopine, Furan, Tetradecanoyl phorbol acetate, Tetrachloroethylene, Diazinon and Dmannitol

Project description:The transcriptomic changes induced in the human liver cell line HepG2 by Azathriopine (250µM, Sigma-Aldrich), Furan (2mM, Sigma-Aldrich), Tetradecanoyl phorbol acetate (500nM, Sigma-Aldrich), Tetrachloroethylene (2mM, Sigma-Aldrich), Diazinon (250µM, Sigma-Aldrich) and Dmannitol (250µM, Sigma-Aldrich) during 4, 8, 24, 48 and 72hrs As a solvent control for Azathriopine, Furan, Diazinon and Tetradecanoyl phorbol acetate, DMSO was used (0.5%); As a solvent control for tetrachloroethylene, ethanol was used (0.5%); As a solvent control for D-mannitol, HBSS was used (0.5%)

2015-01-13 | GSE58235 | GEO

Targeting the Creatine Kinase Pathway in EVI1-Positive Acute Myeloid Leukemia

Project description:Purpose: Identify new targets in EVI1-Positive Acute Myeloid Leukemia Methods: Treatment with cyclocreatine of EVI1-driven AML cell lines TF-1, UT-7 and UCSD-AML1. Cyclocreatine was purchased from Sigma-Aldrich (Sigma). TF-1, UT-7 and UCSD-AML1 cells were treated in quadruplicate with either vehicle or 3 mM cyclocreatine for 24 hours. Total RNA was extracted and profiled by RNA sequencing (HiSeq, Illumina) at BioMicroCenter from Massachusetts Institute of Technology (Cambridge, MA, USA). Results: Alteration of arginine-creatine metabolism by the small-molecule cyclocreatine selectively decreased the viability, promoted cell cycle arrest and apoptosis of EVI1-positive AML cells. Conclusions: Targeting CKMT1 is a promising therapeutic strategy for the EVI1-driven AML subtype that is highly resistant to current treatment regimens.

2017-02-13 | GSE86151 | GEO

A novel response to microtubule perturbation in meiosis

Project description:Cells were grown to saturation in YPD (YEP + 2% glucose) for 24 hours, diluted into YPA (YEP + 2% potassium acetate) at OD600= 0.3 and grown over night at 30C. Cells were washed with sterilized water the next day and re-suspended in SPII medium (0.3% potassium acetate, pH = 7.0) at OD600= 1.9 to induce sporulation. Cells were sporulated at room temperature or 30C as indicated. Sporulation medium containing benomyl was always prepared freshly on the day of the experiment following the directions in {Shonn, 2000 #90}. Briefly, DMSO (dimethyl sulfoxide, Sigma-Aldrich) or benomyl [Methyl 1-(butylcarbamoyl)-2-benzimidazolecarbamate, Sigma-Aldrich; 30 mg/ml stock in DMSO] was dissolved in near-boiling SPII medium to avoid precipitation. The medium was then allowed to slowly cool to 30C or room temperature. At the time of drug treatment, cells were filtered and immediately re-suspended in the medium containing benomyl or DMSO. Keywords = benomyl sporulation saccharomyces microtubule spindle checkpoint Keywords: ordered

2004-10-18 | GSE1693 | GEO

FLASHDeconv Intact protein MS1

Project description:All datasets are generated for evaluation of FLASHDecovn, thus only contain MS1. Cyto dataset, Bovine Cytochrome C (P62894 UniProt accession number), was purchased from Sigma-Aldrich. Filg dataset, filgrastim, was kindly provided by CinnaGen Co. HPLC-grade H2Oacetonitrile (ACN) and formic acid (FA) were purchased from Meck (Darmstadt, Germany). Thermo_STD dataset, Pierce Intact Protein Standard Mix, containing 6 standard proteins namely Protein G, Protein AG, IGF-I LR3, Thioredoxin, Carbonic Anhydrase II, Exo Klenow was purchased from Thermo Scientific (Bremen, Germany).

2019-06-21 | MSV000084001 | MassIVE

Effect of LXR agonist T0901317 on the intestinal transcriptome in mice.

Project description:Mice were treated for three days by oral gavage with the synthetic LXR ligand T0901317 (Cayman chemical, USA) using a dose of 50 mg/kg/day in vehicle (0.5% Carboxy-methylcellulose; 400 cPs (Sigma-Aldrich, USA); 0.2% Tween80 (Sigma-Aldrich, USA)) or solely the vehicle (control group). Mice were anesthetized with isoflurane and euthanized by cardiac puncture followed by cervical dislocation. Intestines were flushed with ice cold PBS and frozen in liquid nitrogen.

2020-10-27 | GSE110528 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data