Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Orthogonal Ionic Liquid-based Extraction Strategy Enables Amyloid-Specific Profiling of the Aggregate Proteome

ABSTRACT: Amyloid deposits are key pathological features of neurodegenerative diseases, yet their structural heterogeneity coupled with a stable β-sheet fibrillar architecture makes them extremely insoluble and difficult to isolate. Through systematic screening and molecular dynamics simulations, we identified the ionic liquid TMGBF4, which disrupts β-sheet hydrogen bonds to specifically and preferentially solubilize amyloid aggregates. By harnessing C12ImCl-mediated hydrophobic interactions, we developed an orthogonal ionic-liquid extraction strategy (Orth-iEA) for highly selective amyloid fibril isolation. Applied to an Alzheimer’s disease mouse model, Orth-iEA enabled in-depth amyloid proteome profiling, enhanced detection of low-abundance proteins, and revealed mitochondrial involvement in amyloid pathology. This methodology delivers a versatile chemical strategy advances amyloid research beyond compositional profiling, enabling high-fidelity isolation and deep proteomic analysis of aggregation-driven pathology.

ORGANISM(S): Mus Musculus

SUBMITTER: Lihua Zhang

PROVIDER: PXD069689 | iProX | Fri Oct 17 00:00:00 BST 2025

REPOSITORIES: iProX

ACCESS DATA

Json Xml

Similar Datasets

Proteome analysis of microvessels from CAA and AD patients

Project description:Cerebral amyloid angiopathy (CAA) is an age-related condition and a major cause of intracerebral hemorrhage and cognitive decline that shows close links with Alzheimer's disease (AD). CAA is characterized by the aggregation of amyloid-β (Aβ) peptides and formation of Aβ deposits in the brain vasculature resulting in a disruption of the angioarchitecture. Capillaries are a critical site of Aβ pathology in CAA type 1 and become dysfunctional during disease progression. Here, applying an advanced protocol for the isolation of parenchymal microvessels from post-mortem brain tissue combined with liquid chromatography tandem mass spectrometry (LC-MS/MS), we determined the proteomes of CAA type 1 cases (n = 12) including a patient with hereditary cerebral hemorrhage with amyloidosis-Dutch type (HCHWA-D), and of AD cases without microvascular amyloid pathology (n = 13) in comparison to neurologically healthy controls (n = 12).

2022-02-16 | PXD029380 | Pride

Insight into the protein composition of immunoglobulin light chain deposits of eyelid, orbital, and conjunctival amyloidosis.

Project description:Amyloidosis is a disorder characterized by the formation of extracellular amyloid deposits. Immunoglobulin light-chain amyloidosis the most common form of amyloidosis can appear as a local disorder presented with mild symptoms or as a life threatening systemic disease. Identification of the proteins forming amyloid fibrils is essential for the diagnosis of the disease and knowledge about the overall protein composition of the deposits may lead to a larger understanding of the deposition events thereby facilitating a more detailed picture of the molecular pathology. In this study, we investigated the protein composition of AL amyloid deposits isolated from human eyelid, conjunctival and orbital specimens. Deposits and internal control tissue (patient tissue without apparent deposits) were procured by laser capture microdissection. Proteins in the captured amyloid and control samples were identified by liquid chromatography tandem mass spectrometry and subsequently quantified using the label-free mass spectrometry quantification method exponential modified Protein Abundance Index. Immunoglobulin light chain kappa or lambda was revealed to be the most predominant protein in the amyloid deposits. In addition, the protein profiles identified apolipoprotein E and serum amyloid P component to be associated with the immunoglobulin light chain deposits across all three tissues analyzed. The method used in this study provides high sensitivity and specificity of typing amyloidosis and may provide additional information on the pathology of amyloidosis.

2014-05-29 | PXD000743 | Pride

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Dysregulation of cholesterol homeostasis is an early signal of beta cell proteotoxicity characteristic of type 2 diabetes.

Project description:Type 2 diabetes (T2D) is a common metabolic disease due to insufficient insulin secretion by pancreatic beta cells in the context of insulin resistance. Islet molecular pathology reveals a role for protein misfolding in beta cell dysfunction and loss with islet amyloid derived from islet amyloid polypeptide (IAPP), a protein co-expressed and co-secreted with insulin. The most toxic form of misfolded IAPP is intracellular membrane disruptive toxic oligomers present in beta cells in T2D and in beta cells of mice transgenic for human IAPP (hIAPP). Prior work revealed a high degree of overlap of transcriptional changes in islets from T2D and pre-diabetic 9-10-week-old mice transgenic for hIAPP with most changes being pro-survival adaptations and therefore of limited therapeutic guidance. Here we investigated islets from hIAPP transgenic mice at an earlier age (6 weeks) to screen for potential mediators of hIAPP toxicity that precede predominance of pro-survival signaling. We identified early suppression of cholesterol synthesis and trafficking along with aberrant intra-beta cell cholesterol and lipid deposits, and impaired cholesterol trafficking to cell membranes. These findings align with comparable lipid deposits present in beta cells in T2D and increased vulnerability to develop T2D in individuals taking medications that suppress cholesterol synthesis.

2024-07-03 | GSE256432 | GEO

Global gene expression profile of INS1E cells, hIAPP-INS1E cells and rIAPP-INS1E cells.

Project description:Islet amyloid polypeptide (IAPP) is the main component of amyloid deposits in type 2 diabetic patients. Cells overexpressing the human transcript of IAPP (hIAPP) present defects in insulin secretion. In this dataset, we include the expression data obtained from the rat pancreatic beta-cells INS1E stably transfected with human (hIAPP) or rat (rIAPP) IAPP, which lead to the overexpression of the different variants of IAPP protein. We also include INS1E cells with empty vector as control. 6 samples were analyzed from 3 INS1E clones stably transfected with different IAPP transcripts.

2014-10-03 | E-GEOD-57573 | biostudies-arrayexpress

Next-generation sequencing of wild type and 5XFAD transcriptomes for Alzheimer's disease study

Project description:We found some novel miRNA that targets SIRT1 may contribute to the pathogenesis in AD mouse model. We first identified that SIRT1 is significantly reduced in Alzheimer patient`s precentral gyrus and 5XFAD mice. To determine whether the strategy of inhibiting some miRNA affects AD pathology, we synthesized antisense oligonucleotides of miRNA (miRNA ASO) and studied this sequence in the brain of 5XFAD through direct intracerebral ventricular injection using stereotaxic instrument. We identified miRNA ASO significantly reduced amyloid beta plaque and amyloid production enzyme. Importantly, the attenuation of amyloid beta plaques through miRNA ASO was caused by a phagocytic activity of glial cells, by which it can directly target CD36. miRNA ASO also decreases inflammatory responses. These results inhibit neuronal loss caused by amyloid beta and leading to improvement of cognitive impairment. These insights of miRNA ASO suggests as therapeutic scope against AD pathology.

2019-12-27 | GSE142633 | GEO

Single-cell RNA-Seq of TauP301L, PS2APP/TauP301L, and PS2APP/TauP301L/TREM2KO mouse hippocampi, 19-22 months old

Project description:Loss-of-function mutations in TREM2 (triggering receptor expressed on myeloid cells 2) strongly increase Alzheimer’s disease (AD) risk. Preclinical models using Trem2 deletion or overexpression have revealed a protective Trem2 function related to β-amyloid accumulation, a process that is most prominent during the pre-diagnosis stages of AD. The role of TREM2 in later AD stages characterized by tau-mediated neurodegeneration is less clear. To understand Trem2 function in the context of both β-amyloid and tau pathologies, we examined Trem2-deficient mice expressing mutant tau alone (pR5-183 model) or in the TauPS2APP model, in which β-amyloid pathology exacerbates tau pathology and neurodegeneration. Single-cell RNA-sequencing in these models revealed robust disease-associated microglia (DAM) activation in TauPS2APP mice that was both amyloid-dependent and Trem2-dependent. In the presence of β-amyloid pathology, Trem2 deletion further exacerbated tau accumulation and spreading and promoted brain atrophy. Without β-amyloid pathology, Trem2 deletion did not affect these processes. Therefore, TREM2 may slow AD progression and reduce tau-driven neurodegeneration by restricting the degree to which β-amyloid facilitates the spreading of pathogenic tau

2021-02-24 | GSE153895 | GEO

Expression profiling of ncRNAs with custom microarray in 3, 10 and 20 month old wild type and 3xTG AD mice

Project description:In this study, we particularly focused on short ncRNA expression profiling of three, ten and twenty month old triple transgenic mouse model for Alzheimers disease (Oddo et al.; 2003;Neuron). These mice harbor presenilin PS1(M146V), APP(Swedish) and tau(P301L) mutations and develop beta-amyloid plaques and at later stages also a tau pathology. Controls are age matched B6129SF2/J mice.

2014-10-31 | E-MTAB-2738 | biostudies-arrayexpress

Alzheimer's disease risk ABCA7 p.A696S variant disturbs the microglial response to amyloid pathology in mice

Project description:The adenosine triphosphate–binding cassette transporter A7 (ABCA7) gene is ranked as one of the top susceptibility loci for Alzheimer’s disease (AD). While ABCA7 mediates lipid transport across cellular membranes, ABCA7 loss of function has been shown to exacerbate amyloid-β (Aβ) pathology and compromise microglial function. Our family-based study uncovered an extremely rare ABCA7 p.A696S variant that was substantially segregated with the development of AD in 3 African American families. Using the knockin mouse model, we investigated the effects of ABCA7-A696S substitution on amyloid pathology and brain immune response in 5xFAD transgenic mice. Importantly, our study demonstrated that ABCA7-A696S substitution reduces amyloid plaque–associated microgliosis and increases dystrophic neurites around amyloid deposits compared to control mice. We also found increased X-34–positive amyloid plaque burden in 5xFAD mice with ABCA7-A696S substitution, while there was no evident difference in insoluble Aβ levels between mouse groups. Thus, ABCA7-A696S substitution may disrupt amyloid compaction resulting in aggravated neuritic dystrophy due to insufficient microglia barrier function. In addition, we observed that ABCA7-A696S substitution disturbs the induction of proinflammatory cytokines interleukin 1β and interferon γ in the brains of 5xFAD mice, although some disease-associated microglia gene expression, including Trem2 and Tyrobp, are upregulated. Lipidomics also detected higher total lysophosphatidylethanolamine levels in the brains of 5xFAD mice with ABCA7-A696S substitution than controls. These results suggest that ABCA7-A696S substitution might compromise the adequate innate immune response to amyloid pathology in AD by modulating brain lipid metabolism, providing novel insight into the pathogenic mechanisms mediated by ABCA7.

2025-03-13 | GSE288170 | GEO

Proteomic and unbiased post-translational modification profiling of amyloid plaques and surrounding tissue in a transgenic mouse model of Alzheimer’s disease

Project description:Amyloid plaques (Aβ plaques) are one of the hallmarks of Alzheimer’s disease (AD). The main constituent of Aβ plaques is beta-amyloid peptides but a complex interplay of other infiltrating proteins also co-localizes. We focused on proteomic differences between Aβ plaques and adjacent control tissue in the transgenic mouse model of AD (APPPS1-21) and in similar regions from non-transgenic littermates. A microproteomic strategy included isolation of regions of interest by laser capture microdissection and analyzed by label-free liquid chromatography mass spectrometry. An in-solution digest protocol with a buffer containing an acid-labile surfactant was used to increase protein solubilization and protease efficiency.

2021-03-25 | PXD014274 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data