Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Proteomics analysis on the VDAC isoforms

ABSTRACT: Proteomic analysis for knock-out for each VDAC isoform in Hela cells.

INSTRUMENT(S): Orbitrap Eclipse

ORGANISM(S): Homo Sapiens (ncbitaxon:9606)

SUBMITTER: Tsui-Fen Chou

PROVIDER: MSV000097150 | MassIVE | Tue Feb 18 18:38:00 GMT 2025

REPOSITORIES: MassIVE

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Next Generation Sequencing Facilitates Quantitative Analysis of control, SETD6 Knock-out, SETD3 knock-out and SETD6+SETD3 knock-out HeLa cells Transcriptomes

Project description:Next Generation Sequencing Facilitates Quantitative Analysis of control, SETD6 Knock-out, SETD3 knock-out and SETD6+SETD3 knock-out HeLa cells Transcriptomes

| PRJNA819059 | ENA

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.

2016-01-11 | GSE69352 | GEO

Ribo-Seq performed in parental or CPEB4 knock-out HeLa cells

Project description:Ribo-Seq performed in parental or CPEB4 knock-out HeLa cells

| PRJNA779948 | ENA

poly(A+) RNAs 3'-seq analysis in control and FUS KD (knock-down) samples

Project description:To understand the effect of FUS protein knock-down on poly(A+) RNAs profiles, we carried out control and FUS depletion (using synthetic siRNAs) experiments followed by poly(A+) RNA 3'-seq anlyais using lexogen kit (016.024)in HeLa cells

2023-02-27 | GSE192821 | GEO

Transcription profiling of human cells embryonic kidney cells (HEK 293 cell line) overexpressing different isoforms of hIMP1 protein

Project description:Regulation of presenilin genes. Presenilins are intramembrane aspartic proteases. These proteases are critical proteins in pathogenesis of Alzheimer's disease. The function of recently identified presenilin-homologous proteases (IMPAS or SPP)s is unknown. Our preliminary data in C.elegans model suggested the role of these proteins in early-development and , perhaps, in pathway related- to cholesterol -regulated signalling (Grigorenko et al, 2004, PNAS). The overall goal is to determine pattern of gene expression alterations in cells with knock-out or knock-down presenilin related proteins (IMPAS). The cultured cells, C.elegans and mouse models are planned to be used in this study. Initially, we will determine gene expression patterns in human cells embryonic kidney cells (HEK 293 cell line) overexpressing different isoforms of hIMP1 protein. We hypothesize that novel family of presenilin-related proteases is important for cholesterol-regulated intracellular signalling and early development (including CNS/neuronal development and function). We will examine in HEK 293 cells effect of over expression of 1) hIMP1 wt protein, 2) over expression of dominant negative isoform of hIMP1 protein and compare their gene expression patterns to 3) HEK 293 cells treated with mock vector. HEK 293 cells were seeded on 10 cm plates and transfected next day using Lipofectamine Plus reagent. 24 hours after cells were washed twice with ice cold PBS buffer and lysed with TRizol reagent directly on plates. Total RNA was extracted, purified according the manufacturer protocol and stored at -800C. We will provide 2 RNA samples for each hIMP1 isoform used in two different transfection experiment to reduce any spurious expression differences resulting from culture condition or transfection efficiency variations.

2008-06-14 | E-GEOD-6276 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Native long-read RNA sequencing of human monocytes reveals activation-induced alternative splicing toward functional isoforms

Project description:Alternative splicing is a key mechanism for expanding transcriptomic and proteomic complexity, yet its role in innate immune activation remains incompletely understood. Here, we applied Oxford Nanopore native RNA sequencing to generate an isoform-level transcriptome of primary human monocytes before and after activation with lipopolysaccharide (LPS). We identify over 24,000 expressed isoforms, including thousands of previously unannotated variants. Activation with LPS induced widespread isoform-specific expression changes, leading to extensive isoform switching events, which were validated using matched short-read RNA-Seq. These activation-induced shifts enhanced transcript immune-regulatory functions: activated monocytes preferentially express longer, coding-competent isoforms with complete open reading frames, fewer retained introns, and increased domain complexity. By integrating matched Ribo-seq and proteomic data, we demonstrate that these isoform modulations are associated with enhanced translation of immune effector proteins. Together, our findings position alternative splicing as a dynamic and functional regulator of monocyte activation, emphasizing the need for isoform-level resolution to fully understand immune cell function and inflammation.

2026-05-04 | GSE297994 | GEO

Gene expression changes in HSV-1 infected HeLa cells with knockdown of B2M

Project description:To understand the global effects of B2M knock-down on host gene expression, the RNA-seq study was carried out using HSV-1 infected HeLa cells transfected with B2M siRNAs (siB2M) or negative control siRNAs (siCTRL)

2019-09-24 | GSE137843 | GEO

Proteomic of control and DNAJC11 knock down HeLa cells and isolated mitochondria

Project description:Proteomic of control and DNAJC11 knock down HeLa cells and isolated mitochondria

2026-02-04 | PXD074067 |

RNA sequencing analysis for cellular metabolic pathway in MARCHF6 Knock-Out HeLa cell lines

Project description:RNA sequencing analysis for cellular metabolic pathway in MARCHF6 Knock-Out HeLa cell lines

| PRJNA725019 | ENA