Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:<p>In this study, we investigated the role of the gut microbiota on the development of complications in kidney transplant recipients. We collected serial fecal specimens from 168 kidney transplant recipients within the first 3 months after transplantation. We performed 16S rRNA gene sequencing of the V4-V5 hypervariable region and examined whether the relative gut abundance of pathogenic bacteria was associated with future development of complications like bacteriuria and urinary tract infections. In a subset of samples, we performed metagenomic sequencing of stool and urine supernatant specimens to determine strain level analysis. </p>
Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.
