Differential binding cell-SELEX
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB28303 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Differential binding cell-SELEX: method for identification of cell specific aptamers by high throughput sequencing
| PRJEB28411 | ENA
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
2019-12-31 | GSE137006 | GEO
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.
2022-02-23 | GSE197262 | GEO
Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.
2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress
Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.
2024-02-01 | GSE254651 | GEO
Project description:Selection of RNA aptamers against human islets by SELEX and toggle SELEX
| PRJNA809588 | ENA
Project description:ssDNA aptamers targeting Salmonella paratyphi A [SELEX]
| PRJNA564266 | ENA
Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment.
2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress
Project description:Quantifying the preferences of DNA binding proteins is an essential step in determining how transcription factors (TFs) interact with their targets in the genome. High-throughput in vitro binding assays have been used to identify the inherent DNA preferences of TFs in a controlled environment isolated from confounding factors such as genome accessibility, DNA methylation, and TF binding cooperativity. Unfortunately, the limited variable region or sequencing depth typically utilized by many of the available experimental approaches makes it difficult to measure the preferences of moderate- to low-affinity binding sites, and impossible to measure small-scale differences between closely related homologs. The Forkhead box (FOX) family of TFs is known to play a crucial role in regulating a variety of key processes from proliferation and development, to tumor suppression and aging. By using the high-sequencing depth SELEX-seq approach to study all four FOX homologs in Saccharomyces cerevisiae, we have been able to precisely quantify the contribution and importance of nucleotide positions flanking the core of the binding sites. Essential to this process was the alignment of our SELEX-seq reads to a set of candidate core sequences determined by two newly developed strategies of alignment and reprioritization applied to enriched k-mers.
2023-04-26 | GSE178811 | GEO