Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
Project description:We report the use of RNA-seq data to assemble transcriptional units of adult Anopheles funestus female mosquitoes. We also analyzed expression levels and protein divergence and discovered SNPs.
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin
Project description:Anopheline mosquitoes frequently take multiple blood meals in a single gonotrophic cycle. In this study we determined patterns of gene expression in Anopheles gambiae females blood fed twice within the first gonotrophic cycle.