Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes


ABSTRACT: In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

ORGANISM(S): Anopheles gambiae

SUBMITTER: Henrique Silveira 

PROVIDER: E-GEOD-26941 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

Similar Datasets

2013-04-02 | GSE26941 | GEO
2014-07-11 | E-GEOD-59258 | biostudies-arrayexpress
2010-08-11 | E-MTAB-195 | biostudies-arrayexpress
2018-10-18 | PXD010121 | Pride
2014-06-01 | E-MTAB-2045 | biostudies-arrayexpress
2014-06-01 | E-MTAB-2009 | biostudies-arrayexpress
2025-12-01 | PXD057585 | Pride
2025-12-01 | PXD057628 | Pride
2011-12-31 | E-GEOD-32200 | biostudies-arrayexpress
2013-08-10 | E-GEOD-49690 | biostudies-arrayexpress