Effects of Plasmodium berghei infection on Anopheles gambiae during oocysts development
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
SUBMITTER: Sebastian Kurscheid
PROVIDER: E-GEOD-32200 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naïve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense. Aseptic and septic midguts and carcasses from P. falciparum-infected A. gambiae vs aseptic and septic midguts and carcasses from uninfected, blood-fed A. gambiae. 3 biological replicates and 1 pseudo-replicate per each array.
2013-08-10 | E-GEOD-49690 | biostudies-arrayexpress
Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal. Midguts from female Anopheles gambiae mosquitoes were dissected at around 24 h after ingestion of P. falciparum-infected blood. Mosquitoes fed on uninfected blood were used as control. A portion of the midguts were used for isolation of total cellular RNA. Extracts of the remaining midguts were fractionated over sucrose density gradients, and fifteen fractions were collected from the top of each gradient. Non-polysomal fractions, as well as polysomal fractions were combined, respectively, to obtain two RNA pools per gradient for three independent experiments. The first, last and the sample between non-polysomal and polysomal, were all discarded to ensure pure pools from each set. A fourth experiment was conducted where the polysomal and non-polysomal samples were not pooled, to be used later for qRT-PCR. The mRNA levels of individual mosquito genes in polysome (PS) fractions, nonpolysome (NP) fractions and unfractionated steady-state (total) RNA were determined using high throughput RNA deep sequencing. Each RNA pool generated 2.1-9.8 million raw read . Signal intensities of transcripts from each PS pool were compared to those of transcripts from a matching NP pool. To quantify the translational status of individual mRNA species, we define the relative PS loading [PL=P/(P+NP)] as the extent of mRNA association with polysomes. PL values were compared between the mosquitoes fed on P. falciparum-infected or -uninfected blood.
2012-09-21 | E-GEOD-38707 | biostudies-arrayexpress
Project description:Anopheline mosquitoes transmit Plasmodium parasites to humans, and are responsible for an estimated 219 million cases of malaria, leading to over 400,000 deaths annually. The mosquito’s immune system limits Plasmodium infection in several ways, and hemocytes, the insect white blood cells, are key players in these defense responses. However, the full functional diversity of mosquito hemocytes and their developmental trajectories have not been established. We use single cell RNA sequencing (scRNA-seq) to analyze the transcriptional profiles of individual mosquito hemocytes in response to blood feeding or infection with Plasmodium. Circulating hemocytes were collected from adult A. gambiae M form (A. coluzzii) females that were either kept on a sugar meal or fed on a healthy or a Plasmodium berghei-infected mouse. Transcriptomes from 5,383 cells (collected 1, 3, and 7 days after feeding) revealed nine major cell clusters.
2020-08-27 | E-MTAB-9240 | biostudies-arrayexpress
Project description:Plasmodium ssp. are pathogens in their vertebrate hosts and also cause deleterious effects to their insect vectors. We show here, however, that Plasmodium-infected mosquitoes more efficiently accumulate energy resources (glycogen) during oocyst development, and survive better when they are starved. Microarray analysis revealed that mosquito metabolism is altered by the presence of rapidly growing oocysts in the midgut. Plasmodium infection is associated with enhanced expression of several insulin-like peptides in mosquitoes and blocking insulin-like signaling results in diminished Plasmodium development. We conclude that Plasmodium infection dramatically changes mosquito metabolism pathways, epitomized by enhanced insulin-signaling, and thereby confer a survival advantage to the insects during periods of starvation. Manipulation of this pathway may provide new strategies to influence the ability of mosquitoes to transmit the protozoa that cause malaria.
2011-12-31 | GSE32200 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Blood feeding is an integral process of the malaria vector Anopheles required for its physiological functions and its propagation. During blood feeding, presence of the malaria parasite, Plasmodium in the blood induces several host effector molecules including microRNAs which play important roles in the development and maturation of the parasite within the mosquito. The present study was undertaken to elucidate the dynamic expression of miRNAs during gonotrophic cycle and parasite development in Anopheles stephensi.For this purpose, miRNA microarray was done in sugar fed, 42 hours post blood fed and 42 hours post infected blood fed female mosquitoes to identify regulated miRNAs under these conditions.
2014-06-01 | E-MTAB-2009 | biostudies-arrayexpress
Project description:Blood feeding is an integral process of the malaria vector Anopheles required for its physiological functions and its propagation. During blood feeding, presence of the malaria parasite, Plasmodium in the blood induces several host effector molecules including microRNAs which play important roles in the development and maturation of the parasite within the mosquito. The present study was undertaken to elucidate the dynamic expression of miRNAs during gonotrophic cycle and parasite development in Anopheles stephensi.For this purpose, small RNA sequencing was done in sugar fed, 42 hours and 5 days post blood fed and infected blood fed female mosquitoes to identify regulated miRNAs under these conditions.
2014-06-01 | E-MTAB-2045 | biostudies-arrayexpress
Project description:Transcriptional responses in the gut of the main malaria vector Anopheles gambiae following oral bacterial infection with the entomopathogen Serratia marcescens were identified using DNA microarrays. S. marcescens is a common member of the mosquito gut microbiota, found in both laboratory reared and field collected mosquitoes, that can be potentially pathogenic as in Drosophila (Nehme et al., 2007), while it has been shown to influence the outcome of Plasmodium infections (Bando et al., 2013). S. marcescens belongs to the Enterobacteriaceae family, members of which have been shown to influence malaria transmission dynamics (Cirimotich et al., 2011, Boissiere et al., 2012). To further investigate the interactions between S. marcescens and the mosquito host, likely to shape, directly or indirectly, malaria transmission dynamics, An. gambiae mosquitoes, from the recently established N'gousso M form laboratory colony that retains much of the genetic variation of field mosquitoes, were antibiotic treated for 5 days and subsequently orally infected with the Db11-GFP strain of S. marcescens. Bacteria-fed mosquitoes were selected 2 days post infection, and, 3 days post infection, guts from bacteria-fed mosquitoes were dissected. Uninfected control mosquitoes were treated in the same way. Differential expression in the gut of S. marcescens infected mosquitoes, compared to uninfected controls, was identified by hybridizing labelled complementary RNA, derived from total RNA extracted from the respective gut pools, in customized Agilent 4x44k gene expression microarrays, comprising oligonucleotide probes encompassing all An. gambiae annotated genes of the AgamP3.6 release, with each probe represented in duplicate.
2013-11-30 | E-MEXP-3952 | biostudies-arrayexpress
Project description:Detoxification genes were assayed for their response to Plasmodium berghei infection at 1 and 11 days post infection in Anopheles gambiae mosquitoes.
2010-08-11 | E-MTAB-195 | biostudies-arrayexpress
Project description:Anopheles gambiae mosquitoes of the M form N'gousso laboratory colony were antibiotic treated and subsequently orally infected with the Db11-GFP fluorescent strain of Serratia marcescens. Bacteria-fed mosquitoes were separated 2 days post infection based on the presence in the mosquito gut of a dye contained in the sugar solution. Mosquitoes were dissected 5 days post infection and the level of S. marcescens infection was determined through microscopic observation of mosquito guts under a fluorescence microscope. Highly infected mosquitoes, with an extensive presence of fluorescent S. marcescens throughout their gut and non-infected mosquitoes, with no sign of fluorescence traced in their gut, were further used for SNP genotyping. Genomic DNA from pools of 15 highly infected and 15 non-infected mosquitoes, in equimolar amounts, was hybridized in a customized Affymetrix 400k SNP genotyping arrays, interrogating genetic variation at ~400,000 variable positions in the An. gambiae genome, as determined by a previous sequencing effort of M/S An. gambiae molecular forms. Allele calls in both array hybridizations were used to determine the minor allele frequency difference for each individual SNP between the two phenotypic pools, which were subsequently used to determine loci associated with the outcome of S. marcescens infection.
2013-11-30 | E-MEXP-3951 | biostudies-arrayexpress