An optimized microRNA scaffold increases shRNA processing and target knockdown
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA263394 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Two shRNAs were placed into expression vectors harboring mir30 microRNA scaffold and an optimized scaffold where the artificial restriction sights in mir30 have been removed. After infection and selection shRNA processing was assessed by small-RNA cloning. For both shRNAs, placement into the optimized scaffold resulted in a ~two-fold increase in processing (based on smallRNA levels). Purpose: Others have reported that the EcoRI site that was introduced to the mir30 scaffold results in decreased smallRNA processing and hence reduced target knockdown. We've developed an alternative scaffold (termed ultramir) where this site is removed. smallRNA cloning was used to determine if the movement of this sight resulted in an increase in shRNA processing. Method: Two shRNAs (one targeting Renilla Luciferase and one targeting Human RPA3) were cloned into the original mir30 cassette the ultramir cassette. Each of the 4 constructs were infected in duplicate at single copy into cells and the cells seltected unitil infection percentages reached >90% (the shRenilla hairpin was infected into HEK293T cells and the shRPA3 construts into the Gallus gallus cell line ERC. After selection smallRNA cloning was perfromed and the amount of smallRNAs corrresponding to the two shRNAs compared to the endogenous microRNA populatlon. Results: smallRNA levels of the two shRNAs doubled relative to the microRNA population when they were placed into the ultramir scaffold.
2014-11-24 | E-GEOD-62187 | biostudies-arrayexpress
Project description:Two shRNAs were placed into expression vectors harboring mir30 microRNA scaffold and an optimized scaffold where the artificial restriction sights in mir30 have been removed. After infection and selection shRNA processing was assessed by small-RNA cloning. For both shRNAs, placement into the optimized scaffold resulted in a ~two-fold increase in processing (based on smallRNA levels).
2014-11-24 | GSE62187 | GEO
Project description:Sub-genomewide shRNA libraries were constructed using the current RNAi consortium constructs as well as using the DSIR (siRNA algoirthm) and a novel shRNA specific algorithm (shERWOOD). All libraries were placed into mir30 expression vectors. The shERWOOD libraries were also placed in a vector harboring an optimized mir cassette (ultramir). Each library was screened using the pancreatic cell line A385. A concensus set of essential genes identified as the set for which two shRNAs depleted in each of the libries. For these genes, a great percentage of shERWOOD seletected shRNA depleted. In addition the placement of shERWOOD selected constructs into ultramir scaffoled increased the rate of shRNA depletion for essential genes further. Purpose: shRNA screens were carried out using various library construction strategies to identify the strategy that provides the best shRNA screening results. Method: Libraries were constructed using the TRC shRNA set as well as shRNAs identified using the DSIR and shERWOOD algorithms. shRNA libraries were cloned into mir30 expression vectors. shERWOOD shRNAs were also cloned into an expression vector harboring an optimized microRNA scaffold termed ultramir. Each resultant library was screened using the pancreatic cell line A385. Each library was analyzed separately to identify a set of genes where at least two shRNAs depleted. These gene sets were intersected to develop a set of essential genes. Results: The shERWOOD shRNA libraries provided the highest number depleting shRNAs for each essential gene. Further these shRNAs depleted to a greater extent than did the shRNAs from the other libraries. When shERWOOD libraries were placed into the ultramir cassette a greater number of shRNAs per essential gene depleted.
2014-11-24 | E-GEOD-62185 | biostudies-arrayexpress
Project description:Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying functional circRNAs
| PRJNA682745 | ENA
Project description:Purpose: Identical predicted small interfering RNA (siRNA) sequences targeting Apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct compariso of the possible aspecific off-target effects in vivo was performed. Next generation sequencing (NGS) of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5M-bM-^@M-^Y and 3M-bM-^@M-^Y cleavage sites and abundance of the guide or passenger strands. Methods [1]: Total liver RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturerM-bM-^@M-^Ys protocol. Each read file (sample), in the FASTQ format, was individually aligned against the mouse reference genome (15 May 2012 NCBI build 38.1) using CLC Bio-Genomic Workbench and the expression abundance for each gene (RPKM) was calculated according to Montazavi et al. Result [1]s: Based on our previous observations that shApoB and miApoB are differentially processed and that miApoB has a different passenger, we checked for possible aspecific off-target effects in vivo. NGS liver transcriptome analysis was performed 8 weeks p.i. for animals injected with 1x1011 gc AAV encoding shScr, shApoB, miScr and miApoB. We investigated whether shApoB and miApoB processing differences translate into differences in gene expression in injected animals. A total number of 266 genes were significantly changing (p <0,05) in miApoB-injected mice compared to miScr. Additionally 106 genes were found to be significantly up or down-regulated in the shApoB mice compared to shScr. Off-target predictions using Smith-Waterman algorithm for the most abundant guide and passenger strand variants were performed to investigate if any of the observed changes results from aspecific interactions. None of the changing genes had predicted targets for the guide or passenger strands of shApoB or miApoB. Conclusions [1]: An important observation is that none of the changes in gene expression in AAV-miApoB and AAV-shApoB can be explained by possible aspecific down-regulation of non-target transcripts. Methods [2]: For NGS analysis cells were transfected with 4 M-BM-5g shApoB- or miApoB-expression plasmids using Lipofectamine 2000 reagent and total RNA was isolated from cells 48 hr post-transfection using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturerM-bM-^@M-^Ys protocol. Total RNA sequencing libraries for the Illumina sequencing platform were generated using high-quality total RNA as input and the Illumina TrueSeq RNA v2 Sample preparation kit according to the manufacturerM-bM-^@M-^Ys protocol. The NGS small RNA raw data set was analyzed using the CLC_bio genomic workbench (CLC Bio, Aarhus, Denmark). The obtained reads were adaptor-trimmed, which decreased the average read size from ~36bp to ~25bp. The custom adapter sequenced used for trimming all the bases extending 5M-bM-^@M-^Y was: GTGACTGGAGTTCC-TTGGCACCCGAGAATTCCA. All reads containing ambiguity N symbols, reads shorter than 15 nt, longer than 55 nt in length and reads represented less than 10 times were discarded. Next, both data sets from shApoB and miApoB samples were grouped based on the match to the reference sequence and the obtained unique small RNAs were aligned to the sequence of pre-miApoB: GATCCTGGAGGCTTGC-TGAAGGCTGTATGCTGATGGACAGGTCAATCAATCTTGTTTTGGCCACTGACTGACAAGATTGAGACCTGTCCATCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCAG or shApoB: GATCCCCGATTGATTGACCTGTCCATTTCAAGAGAATGGACAGGTCAATCAATC-TTTTTCAGCTT sequence, respectively. To relatively represent the expression counts for the small RNAs obtained in the experiment, reads per million (rpm) or percentage of reads based on the total number of reads matching the reference shApoB or miApoB sequence were calculated Results [2]: The small RNAs were aligned against their reference sequence resulting in 541.939 reads matching shApoB and 1.525.211 reads matching miApoB (Fig S1 and S2). Analysis of the length distribution of the reads indicated that siApoB guide strand originating from shApoB ranged between 19 and 23 nt, with the most abundant one being 21 nt-long. Surprisingly, siApoB guide from miApoB scaffold ranged from 23 to 25 nt with the 24 nt-long strand being the predominant variant. This finding was rather unexpected considering that the predicted guide strand of siApoB was 21 nt long for both shApoB and miApoB scaffolds. Analysis of the processed 5M-bM-^@M-^Y ends of the siApoB guide strand indicated that most of the reads matched position +1 relative to the predicted cleavage site for shApoB, while all the reads matched position 0 for miApoB. The 3M-bM-^@M-^Y ends of the siApoB guide strand had a more heterogeneous pattern and ranged from -1 to +3 for shApoB and +1 to +4 for miApoB. Next, we looked at the sequence distribution and percentage of reads for both the guide and passenger siApoB strands originating from the shApoB and miApoB scaffolds. A substantial difference between the two is that the guide from shApoB is in the 3M-bM-^@M-^Y arm and hence Dicer or other endonuclease defines the cleavage position while the guide is present in the 5M-bM-^@M-^Y arm of miApoB, where Drosha defines the cleavage. Thus, defining the length and exact cleavage position for the guide and passenger strands is very important since even single nucleotide differences may result in significant changes in the predicted targets of the siRNAs. Moreover, the passenger siRNA* strand, if not degraded efficiently, may bind to unanticipated targets and cause off-target effects. As expected, 44.4% of the reads originating from shApoB matched the siApoB guide strand but processing was shifted at position +1 (Fig. 2d, upper panel). Surprisingly only 12.1% of the reads matched perfectly the predicted siApoB guide strand of 21 nt and starting at position 0. The reads matching the passenger siApoB* strand were represented in much lower percentage with the predominant one being only 5.3%. Analysis of the guide strand from the siApoB reads originating from the miApoB scaffold indicated that they all started at the predicted cleavage site. Surprisingly, the predominant, 22.3% of reads were 24 nt-long. Furthermore 5.1% reads were 23 nt- and 1.9% were 25 nt-long. A substantial number of 62% of the reads was found matching the passenger siApoB* strand and ranged between 20 and 22 nt in length. In conclusion, both shApoB and miApoB scaffolds did not yield the predicted siApoB guide or siApoB* passenger sequences after processing from the cellular RNAi machinery. The guide from miApoB was cleaved much more precisely by Drosha at its 5M-bM-^@M-^Y end compared to shApoB that gave more heterogeneous pools of sequences following processing. Conclusions[2]: An unexpected discovery in the current study was that siRNA processing by the cellular RNAi machinery did not follow the generally accepted and described cleavage sites for both molecules shApoB and miApoB siApoB guide strand originating from the shApoB scaffold was more heterogeneous in cleavage sites and length compared to the product originating from the miApoB scaffold. Most likely, differential cleavage mechanism defined the heterogeneity in the guide and passenger strands. Additionally, shRNAs with 19 bp stem or less are not necessarily recognized by Dicer and maybe be processed differently. The heterogeneity seen with the shApoB can also be explained by the potential for 2 or 3 uridines to be added following termination of pol III transcription. The main pool of guide sequences originating from miApoB was 24 nt-long although we used the scaffold of cellular pri-mir-155 that produces a 23 nt mature miRNA. However, a 24 nt-long siApoB sequence did not compromise efficacy because when placed in the miApoB scaffold, the ApoB target sequence was extended at the 3M-bM-^@M-^Y end with 4 nt until the loop. Another important observation is that the siApoB* Liver mRNA profiles of C57BL/6 9 weeks after intravenous AAV injection of 1x1011 gc per animal (~4x1012 gc/kg) of AAV-shRNA, AAV-miRNA or PBS via the tail vein. Next Generation Sequencing on Illumina platform
2012-07-10 | E-GEOD-39187 | biostudies-arrayexpress
Project description:This study investigated early host reactions to implanted materials to predict successful tissue regeneration with implant. Three kinds of scaffold, i.e., non-coat, collagen-coated, and PMB-coated porous polystylene scaffolds were implanted subcutaneously in mice dorsal area. Those scaffolds were used as bio-incomopatible materials, appropriate materials for tissue regeneration (bio active), and inappropriate to regenration (bio-inert) scaffolds. Seven days after implantation, scaffolds were explanted and total RNA was isolated from infiltrated host cells into scaffold by laser microdissection. Gene expressions of cells in collagen- and PMB-coated scaffold were normalized using results of non coat scaffold. Genes with more than 2-fold difference between collagen and PMB were picked up and narrowed to related keywords; inflammation, angiogenesis, wound healing, and mcrophage polarization. Among those genes, interluekin (IL)-1beta which promote both inflammation and wound healing was up-regulated in collagen-coated scaffold. On the other hand, IL-10 which suppress both inflammation and wound healing was up-regulated in PMB-coated scaffold. Angiogenesis-promoting genes were up-regulated and angiogenesis suppressve genes were suppressed in collagen. Up-regulation of IL-1b and the angiogenesis-relating genes inside the porous scaffolds are the possibly important factors for controlling tissue regeneration. Three-condition experiment, host cells infiltrated in non coat (reference), collagen-coated, and PMB-coated scaffolds. Two-microarray condition experiments, collagen vs. non coat and PMB coat vs. non coat. Hybridization: 2 replicates. Scanning: 3 replicates. Biological experiments: once.
2014-01-23 | E-GEOD-52053 | biostudies-arrayexpress
Project description:Circular RNAs (circRNAs) are widely expressed, but their functions remain largely unknown. To study circRNAs in a high-throughput manner, short hairpin RNA (shRNA) screens1 have recently been used to deplete circRNAs by targeting their unique back-splicing junction (BSJ) sites. Here, we report frequent discrepancies between shRNA-mediated circRNA knockdown efficiency and the corresponding biological effect, raising pressing concerns about the robustness of shRNA screening for circRNA functional characterization. To address this issue, we leveraged the CRISPR/Cas13d system2 for functional study of circRNAs by optimizing the strategy for designing single guide RNAs to deplete circRNAs. We then performed shRNA and CRISPR/Cas13d parallel screenings and demonstrated that shRNA-mediated circRNA screening yielded a high rate of false positive phenotypes. Furthermore, using a CRISPR/Cas13d screening library targeting over 2,500 human hepatocellular carcinomas (HCC) related circRNAs, we identified a group of circRNAs, whose inhibition increased the therapeutic efficacy of sorafenib, an approved HCC drug. Collectively, these data demonstrate that CRISPR/Cas13d system is an effective approach to study the function of circRNAs in a high-throughput manner.
2020-12-06 | GSE162720 | GEO
Project description:Improving fibroblast characterization using single-cell RNA sequencing: an optimized tissue disaggregation and data processing pipeline
| PRJNA521040 | ENA
Project description:The nuclear scaffold/matrix provides an anchor for higher order genome structure that has both structural and functional implications. Different extraction protocols, i.e., utilizing either 25 mM LIS or 2 M NaCl, isolate somewhat different protein constituents of either the nuclear scaffold or nuclear matrix respectively. We have mapped, by array CGH, the locations of attachment to each of these residual protein bodies relative to non-attached DNA along the entire length of human chromosomes 14, 15, 16, 17 and 18 in HeLa cells. LIS or 2 M NaCl solutions followed by restriction digestion with EcoR1 facilitates the separation from scaffold/matrix bound DNA from non bound DNA. Genomic CGH arrays were used to map the relative differences between attached (scaffold/matrix) and non-attached (loop) portions of HeLa DNA. The expression profile of the HeLa cells used for aCGH analysis was also determined.
2010-05-22 | E-GEOD-13774 | biostudies-arrayexpress
Project description:Human Burkitt's lymphoma ST486 cells were transduced with non-target control shRNA lentiviral vectors, FOXM1 shRNA, and MYB shRNA lentiviral vectors. Total RNA was isolated 24h later. cRNA was produced with the standard one-step IVT protocol (Affymetix) and hybridized in U95Av2 gene chips (Affymetrix). Experiment consists in 3 independent samples: Expression profiling of Burkitt's lymphoma cells 24h after non-target control shRNA lentiviral mediated transduction. Expression profiling of Burkitt's lymphoma cells 24h after FOXM1 shRNA lentiviral mediated transduction. Expression profiling of Burkitt's lymphoma cells 24h after MYB shRNA lentiviral mediated transduction. Data processing performed using MAS5 or GCRMA.
2009-07-27 | E-GEOD-17172 | biostudies-arrayexpress