Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach. Phylogenetic study of the Treponema taxa found in digital dermatitis lesions of Holstein cows.
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:We used 16S V3/V4 region amplification to evaluate the composition of bacteria species in mouse fecal pellets. Fecel pellets were collected from young-adult (12 weeks old) wild type C57Bl/6 mice and aged (72 weeks old) wild type C57Bl/6 mice after 21 days of vehicle or antibiotics treatment (to induce gut microbiota depletion). In one sequencing round, we sequenced a total of 12 different fecal samples (3 young control, 3 aged control, 3 young depleted gut microbiota (ABX) and 3 aged depleted gut microbiota (ABX)). Amplicons were indexed using the Nextera XT Index Kit and pooled into a library for Illumina sequencing.
