Ontology highlight
ABSTRACT:
PROVIDER: PRJNA417113 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:DNA sequencing for Round 5 of the pHLA-A2 yeast display library selection for MA2 Fab
2022-10-09 | GSE210479 | GEO
Project description:Display technologies, e.g., phage, ribosome, mRNA, bacterial, and yeast-display, combine high content peptide libraries with appropriate screening strategies to identify functional peptide sequences. Construction of large peptide library and display-screen system in intact mammalian cells will facilitate the development of peptide therapeutics targeting transmembrane proteins. Our previous work established linear-double-stranded DNAs (ldsDNAs) as innovative biological parts to implement AND gate genetic circuits in mammalian cell line. In the current study, we employ ldsDNA with terminal NNK degenerate codons as AND gate input to build highly diverse peptide library in mammalian cells. Only PCR reaction and cell transfection experiments are needed to construct the library. High-throughput sequencing (HTS) results reveal that our new strategy could generate peptide library with both amino acid sequence and peptide length diversities. Our work establishes ldsDNA as biological parts for building highly diverse peptide library in mammalian cells, which shows great application potential in developing therapeutic peptides targeting transmembrane proteins.
2020-07-19 | GSE134671 | GEO
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:We report the construction of 5 yeast meiotic cDNA libraries and perform proof-of-principle screens to show that these yeast cDNA libraries can be used to identify genes and gene isoforms that are important for competitive fitness. Samples 1-25 are from different stages of cDNA library construction and deep sequencing was used to characterize gene representation in each yeast cDNA library. Samples 26-175 are from proof-of-principle competitive fitness screens.
2021-05-12 | GSE174268 | GEO
Project description:To determine the contribution of yeast genes to acute lethal ethanol stress, we performed fitness profiling of a pooled haploid yeast deletion library. This deletion library contains 4,500 deletions of most non-essential yeast genes. Comparing the abundance of post-stress gene deletions to pre-stress gene deletions allows for the quantification of the effects of each gene deletion on survival
2020-09-17 | GSE151784 | GEO
Project description:Lipid intermediates derived from sphingolipid metabolism are crucial regulators of mitochondrial function from yeast to humans. Among these intermediates, trans-2-hexadecenal (t-2hex) within the sphingolipid degradation pathway exhibits remarkable efficiency in inducing mitochondria-mediated cell death. In yeast cell cultures, the addition of t-2-hex triggers complete disintegration of the mitochondrial network, leading to subsequent cell death. This effect is particularly pronounced in yeast cells lacking the activity of the t-2-hex degrading enzyme, Hfd1. However, the molecular mechanisms of t-2-hex induction of mitochondrial dysfunction are completely unknown. In this project, we want to exploit the unprecedented power of yeast genetics to unveil novel genetic determinants involved in t-2-hex's pro-apoptotic function. To accomplish this, we employed the SATAY method, which combines saturated transposon mutagenesis with high-throughput sequencing to functionally explore the yeast genome. In our screening approach, hfd1 mutant cells harboring a plasmid-encoded inducible MiniDs transposon were induced by galactose, resulting in extensive integration of the transposon throughout the yeast genome. Cells with the plasmid excised and the transposon genomically integrated were pooled together, creating a high-density transposon library comprising approximately 2.3E+06 independent insertion mutants. Subsequently, the pooled mutant library was subjected to treatment with the mitochondria-mediated death inducer, t-2-hexadecenal. As a control, cells were also incubated with the solvent dimethyl sulfoxide (DMSO), in which hexadecenal is dissolved. Following the treatments, cells were collected for genomic DNA extraction and digestion, using restriction enzymes with frequent four-base pair recognition sites. The resulting library fragments were circularized using T4 DNA ligase, and the transposon-genome junctions were selectively amplified through PCR with outward-facing primers specific to the transposon. Finally, the pooled and purified amplicons were subjected to massive sequencing on an Illumina MiSeq platform. The obtained sequences were then aligned to the reference genome of Saccharomyces cerevisiae, allowing for the mapping of transposon insertions and the calculation of transposon counts per gene. This project enabled the identification of genes required for the resistance and toxicity to t-2hex.
2023-08-31 | E-MTAB-13208 | biostudies-arrayexpress
Project description:Phagocytosis is the process by which myeloid phagocytes bind and internalize potentially dangerous microbes. During phagocytosis, innate immune receptors and the associated signaling adapters are localized to the maturing phagosome compartment. We used proximity labeling of phagosomal contents (PhagoPL) to identify proteins localizing to phagosomes containing model yeast and bacteria and identified programmed death-ligand 1 (PD-L1) as a protein that specifically enriches in phagosomes containing yeast. We found that PD-L1 directly binds to yeast upon processing in phagosomes. By surface display library screening, we identified the ribosomal protein RPL20B as a fungal protein ligand for PD-L1. Using an auxin-inducible depletion system, we found that detection of RPL20B by macrophages influences production of a subset of inflammatory cytokines and chemokines produced when macrophages encounter yeast.
2024-04-19 | GSE235078 | GEO
Project description:RNA sequencing of 968xY0036 fission yeast recombinant library
| PRJEB6554 | ENA