Project description:Haploid, diploid, and tetraploid yeast were experimentally evolved in 2% raffinose medium. After 250 generations, we assessed the gene expression alterations in 2 evolved haploids, 2 evolved diploids, and 4 evolved tetraploids relative to the diploid ancestor.
Project description:Transcriptional change by profiling yeast cells, comparing polyploid S. cerevisiae cells at 1000 generations with ancestral cells. Transcriptional change by profiling yeast cells, comparing both ancestral and evolved cells with diploid cells, stands for control.
Project description:Analysis of copy number variation in evolved haploid, diploid, tetraploid strains. All experimental samples were compared to the same reference strain S288C. The samples include the progenitor strains for the haploid, diploid, and tetraploid evolution experiments, and single colony isolates (clones) from the evolving populations at given time points. Evolved clones were analyzed at generation 250 unless the name is followed by gen35, gen55 or gen500, in which case those generations were analyzed.
Project description:Genome expression analysis between the yeast wine strain L-846 (diploid heterozygous) and spore derived from it (diploid homozygous).
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
Project description:We report the high-throughput profiling of histone modification (H3K9me2) or histone variant CNEP-A/Cnp1 in fission yeast Schizosaccharomyces pombe. By obtaining 1-10 ng immunoprecipitated DNA, we generated genome-wide H3K9me2 or CENP-A/Cnp1 maps of heterozygous deletion diploid mhf2∆/+ and the meiotic haploid progeny of heterozygous deletion diploid wip1∆/+, mhf1∆/+ and mhf2∆/+ in fission yeast. We find that centromere inactivation and neocentromere formation occur independently and postzygotically in single depletion of CENP-T-W-X-S.
