Transcriptomic analysis of myosin IIa-deficient B cells
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA450071 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Myosin IIa-deficient follicular B cells have a hyperactivated phenotype. To identify what pathways are regulated by myosin IIa, we performed RNA-seq of coding RNA on flow cytometry sorted follicular B cells from CD23Cre+Myh9fl/fl and CD23Cre+Myh9wt/fl mice.
2018-04-14 | GSE113114 | GEO
Project description:The Borg5/Cdc42EP family comprises septin binding proteins, which are known to participate in septin-dependent stress fiber formation. We show here that epithelial Borg5/Cdc42Ep1 restrains stress fibers instead. Borg5 decorates septin filament-aligned thin F-actin filaments under the nucleus of MDCK cells, which in Borg5 depleted cells are replaced by thick stellate stress fibers. These associate with either cell-substratum- or cell-cell- adhesions, increasing tension on E-cadherin based junctions and causing MDCK cells to undergo collective streaming. We identified two known septin partners, Myosin-IIA and alpha Actinin 4 (ACTN4), among proteins that co isolated with Borg5 from MDCK lysates. We found that Borg5 binds Myosin-IIA and ACTN4 directly and negatively regulates their F-actin association. Since both septin partners along with Septins 2 and 9 were furthermore required for the Borg5 depletion-induced F actin phenotype, we propose that Borg5 prevents stellate stress fiber formation by counteracting septin dependent ACTN4 and Myosin IIA activities. The mass spectrometry raw files and search results for Borg 5 affinity purifications are deposited here.
| MSV000092958 | MassIVE
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
2023-12-18 | GSE202685 | GEO
Project description:In addition to altered gene expression, pathological cytoskeletal dynamics in the axon are another key intrinsic barrier for axon regeneration in the central nervous system (CNS). Here we showed that knocking out myosin IIA/B in retinal ganglion cells alone either before or after optic nerve crush induced significant optic nerve regeneration. Combined Lin28a overexpression and myosin IIA/B knockout led to additive promoting effect and long-distance axon regeneration. Immunostaining, RNA sequencing and western blot analyses revealed that myosin II deletion did not affect known axon regeneration signaling pathways or the expression of regeneration associated genes. Instead, it abolished the retraction bulb formation and significantly enhanced the axon extension efficiency. The study provided clear evidence that directly targeting neuronal cytoskeleton was sufficient to induce significant CNS axon regeneration, and combining altered gene expression in the soma and modified cytoskeletal dynamics in the axon was a promising approach for long-distance CNS axon regeneration
2020-03-22 | GSE147328 | GEO
Project description:In addition to altered gene expression, pathological cytoskeletal dynamics in the axon are another key intrinsic barrier for axon regeneration in the central nervous system (CNS). Here we showed that knocking out myosin IIA/B in retinal ganglion cells alone either before or after optic nerve crush induced significant optic nerve regeneration. Combined Lin28a overexpression and myosin IIA/B knockout led to additive promoting effect and long-distance axon regeneration. Immunostaining, RNA sequencing and western blot analyses revealed that myosin II deletion did not affect known axon regeneration signaling pathways or the expression of regeneration associated genes. Instead, it abolished the retraction bulb formation and significantly enhanced the axon extension efficiency. The study provided clear evidence that directly targeting neuronal cytoskeleton was sufficient to induce significant CNS axon regeneration, and combining altered gene expression in the soma and modified cytoskeletal dynamics in the axon was a promising approach for long-distance CNS axon regeneration
2020-03-24 | GSE147400 | GEO
Project description:Transcriptomic analysis of NF2 deficient AB12 cells
| PRJNA658530 | ENA
Project description:Congenital myopathies are rare genetic muscle diseases notably due to mutations in the MYH2 gene. Here we assessed their myosin heavy chain post-translational modifications. For that, we purified beta/slow and type IIa myosin heavy chains from limb muscles of five patients and five healthy controls. We then ran a LC/MS analysis.
2023-01-30 | PXD039178 | Pride
Project description:Global microarray (HG U133 Plus 2.0) was used for the first time to investigate the effects of resistance exercise on the transcriptome in slow-twitch myosin heavy chain (MHC) I and fast-twitch MHC IIa muscle fibers of young and old women. Vastus lateralis muscle biopsies were obtained pre and 4hrs post resistance exercise in the beginning (untrained state) and at the end (trained state) of a 12 wk progressive resistance training program. A total of 14 females were included in this investigation. The participants included 8 young (23±2y) and 6 old (85±1y) females. All subjects participated in 12 wks of progressive resistance training consisting of bilateral knee extensions with 3x10 reps at 70% of 1-RM, and 3d/wk for a total of 36 training sessions. Vastus lateralis biopsies were obtained in conjunction with the 1st and 36th (last) training session and included a basal biopsy and another biopsy 4hrs post the resistance exercise session. From each biopsy sample, we isolated individual muscle fibers. After myosin isoform identification of isolated fibers (SDS-PAGE), RNA extraction of 20 MHC I and 20 MHC IIa muscle fibers per biopsy sample followed. Thus, each resulting sample contained total RNA from 20 muscle fibers of identical fiber type (MHC I or MHC IIa). A total of 70 samples were analyzed on separate microarray chips, and samples were not pooled between subjects. The study design allowed us to examine the acute effects of resistance exercise on the transcriptome in MHC I and MHC IIa muscle fibers in the untrained and trained state.
2012-02-21 | E-GEOD-28392 | biostudies-arrayexpress
Project description:RNA-Seq was used for the first time to investigate the effects of resistance exercise on transcriptome dynamics in slow myosin heavy chain (MHC) I and fast MHC IIa muscle fibers among 3 groups of men. Vastus lateralis muscle biopsies were obtained before and 4 hours after resistance exercise.
2024-01-08 | GSE235781 | GEO
Project description:Transcriptomic analysis of agr-deficient Staphylococcus aureus
| PRJNA497884 | ENA