Napa cabbage phyllosphere
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA510140 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Arthrobacter chlorophenolicus A6 is a 4-chlorophenol degrading soil bacterium with high phyllosphere colonization capacity. Till now the genetic basis for the phyllosphere competency of Arthrobacter or other pollutant-degrading bacteria is uncertain. We investigated global gene expression profile of A. chlorophenolicus grown in the phyllosphere of common bean (Phaseolus vulgaris) compared to growth on agar surfaces.
2013-06-21 | GSE48198 | GEO
Project description:Tomato Phyllosphere 16S and ITS Amplicon Sequencing
| PRJNA578761 | ENA
Project description:Arthrobacter chlorophenolicus A6 is a 4-chlorophenol degrading soil bacterium with high phyllosphere colonization capacity. Till now the genetic basis for the phyllosphere competency of Arthrobacter or other pollutant-degrading bacteria is uncertain. We investigated global gene expression profile of A. chlorophenolicus grown in the phyllosphere of common bean (Phaseolus vulgaris) compared to growth on agar surfaces. We designed transcriptome arrays and investigated which genes had different transcript levels in the phyllosphere of common bean (Phaseolus vulgaris) as compared to agar surfaces. Since water availability is considered an important factor in phyllosphere survival and activity, we included both high and low relative humidity treatments for the phyllosphere-grown cells. In addition, we determined the expression profile under pollutant exposure by the inclusion of two agar surface treatments, i.e. with and without 4-chlorophenol.
2013-06-21 | E-GEOD-48198 | biostudies-arrayexpress
Project description:Deep sequencing provided evidence that a novel subset of small RNAs were derived from the chloroplast genome of Chinese cabbage (Brassica rapa) and Arabidopsis (Ler). The chloroplast small RNAs (csRNAs) include those derived from mRNA, rRNA, tRNA and intergenic RNA. The rRNA-derived csRNA were preferentially located at the 3M-CM-"M-BM-^@M-BM-^Y-ends of the rRNAs, while the tRNA-derived csRNAs were mainly located at 5M-CM-"M-BM-^@M-BM-^Y-termini of the tRNAs. After heat treatment, the abundance of csRNAs decreased in chinese cabbage seedlings, except those of 24 nt in length. The novel heat-responsive csRNAs and their locations in the chloroplast were verified by Northern blotting. The regulation of some csRNAs to the putative target genes were identified by real-time PCR. Our results indicated that high temperature regulated the production of some csRNAs, which may have potential roles in transcriptional or post-transcriptional regulation, and affected putative target genes expression in chloroplast. Examination of two replicates of heat treated (HT) and control (MT) Chinese cabbage sample respectively, and one Arabidopsis (Ler) RNA sample.
2012-03-30 | E-GEOD-28281 | biostudies-arrayexpress
Project description:Deep sequencing provided evidence that a novel subset of small RNAs were derived from the chloroplast genome of Chinese cabbage (Brassica rapa) and Arabidopsis (Ler). The chloroplast small RNAs (csRNAs) include those derived from mRNA, rRNA, tRNA and intergenic RNA. The rRNA-derived csRNA were preferentially located at the 3â-ends of the rRNAs, while the tRNA-derived csRNAs were mainly located at 5â-termini of the tRNAs. After heat treatment, the abundance of csRNAs decreased in chinese cabbage seedlings, except those of 24 nt in length. The novel heat-responsive csRNAs and their locations in the chloroplast were verified by Northern blotting. The regulation of some csRNAs to the putative target genes were identified by real-time PCR. Our results indicated that high temperature regulated the production of some csRNAs, which may have potential roles in transcriptional or post-transcriptional regulation, and affected putative target genes expression in chloroplast.
2012-03-31 | GSE28281 | GEO
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:This study aims at investigating the gene expression profile of thermogenic skunk cabbage (Symplocarpus renifolius). Using Super-SAGE, we compared the gene expression profile of different developmental stages of skunk cabbage spadices.
2011-12-22 | GSE29852 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO