TPR Knockdown Frac-Seq
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA559187 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Frac-Seq Analysis of ZFC3H1 Knockdown U2OS Cells
| PRJNA735123 | ENA
Project description:To identify changes in splicing patterns following WTAP and TPR knockdown, RNA-sequencing was performed on breast cancer cells transfected with siRNAs targeting WTAP or TPR.
2019-12-26 | GSE130873 | GEO
Project description:Total RNA-seq of siRNA-mediated WTAP and TPR knockdown
| PRJNA541857 | ENA
Project description:How splicing regulates the nuclear export of mRNAs has been a source of much debate. While splicing has been shown to enhance nuclear export, it has remained unclear whether mRNAs generated from intronless genes use specific machinery to promote their export. Here we investigate the role of the major nuclear pore basket protein, TPR, in regulating mRNA and lncRNA nuclear export. We provide evidence that TPR is required for the nuclear export of mRNAs and lncRNAs that are generated from intronless or intron-poor genes. In contrast, TPR is not required for the nuclear retention of mRNAs that have retained introns, or unused 5’ splice site motifs. In summary, our study provides one of the first examples of a factor that is specifically required for the nuclear export of intronless mRNAs.
2020-10-02 | GSE135537 | GEO
Project description:We used SLAM-seq approach to define a contribution of RNA synthesis into RNA abundance changes after Tpr loss. Basket nucleoporin Tpr was AID-tagged and depleted through Auxin Induced Degradation system. Loss of Tpr led to rapid changes in rates of RNA synthesis. The majority of transcripts were downregulated. Analysis of RNA-seq and SLAM-seq indicated that the changes in RNA abundance of most of Tpr-dependent up- and downregulated genes resulted from increased or decreased rates of RNA synthesis, respectively.
2020-06-15 | GSE149890 | GEO
Project description:RNA-seq 2-cell Suv392 knockdown
| PRJNA522081 | ENA
Project description:RNA-seq CELSR2 knockdown vs NTC
| PRJNA474741 | ENA
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress