Project description:Gas hydrates, also known as clathrates, are cages of ice-like water crystals encasing gas molecules such as methane (CH4). Despite the global importance of gas hydrates, their microbiomes remain mysterious. Microbial cells are physically associated with hydrates, and the taxonomy of these hydrate-associated microbiomes is distinct from non-hydrate-bearing sites. Global 16S rRNA gene surveys show that members of sub-clade JS-1 of the uncultivated bacterial candidate phylum Atribacteria are the dominant taxa in gas hydrates. The Atribacteria phylogeny is highly diverse, suggesting the potential for wide functional variation and niche specialization. Here, we examined the distribution, phylogeny, and metabolic potential of uncultivated Atribacteria in cold, salty, and high-pressure sediments beneath Hydrate Ridge, off the coast of Oregon, USA, using a combination of 16S rRNA gene amplicon, metagenomic, and metaproteomic analysis. Methods were developed to extract bacterial cellular protein from these sediments, as outlined below. Sample Description Three sediments samples were collected from beneath Hydrate Ridge, off the coast of Oregon, USA. Sediments were cored at ODP site 1244 (44°35.1784´N; 125°7.1902´W; 895 m water depth) on the eastern flank of Hydrate Ridge ~3 km northeast of the southern summit on ODP Leg 204 in 2002 and stored at -80°C at the IODP Gulf Coast Repository. E10H5 sediment is from 68.5 meters below sediment surface interface C1H2 sediment is from 2 meters below sediment surface interface. C3H4 sediment is from 21 meters below sediment surface interface.
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.