Ontology highlight
ABSTRACT:
PROVIDER: PRJNA624221 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Interventions: Case vs control:No
Primary outcome(s): High-throughput sequencing
Study Design: Case-Control study
| 2676067 | ecrin-mdr-crc
Project description:The rapid development of high-throughput sequencing is conducive to the discovery of many new theories. The purpose of this study is to explore the differentially expressed of tRF & tiRNA in cholangiocarcinoma by high-throughput sequencing technology. We collected cholangiocarcinoma and adjacent normal tissues from three patients. After RNA extraction and RNA library preparation, we determined the raw data of tRF & tiRNA in cholangiocarcinoma and adjacent normal tissues by high-throughput RNA sequencing. Raw data were generated after sequencing,image analysis,basecalling and quality filtering on lllumina sequencer.Firstly,Q30 was used to perform quality control.The adaptor sequences were trimmed and the adaptor-trimmed-reads(>=16nt) were left by cut adapt software(v1.9.3).Then,the raw counts of each tRF&tiRNA(MINTbasev2.0) was calculated for all samples,defined as the raw expression level soft.The results showed that a total of 20102 tsRNA were detected in the two groups, 9616tsRNA were upregulated and 10486 were downregulated. There were 535 differentially expressed tsRNA in cholangiocarcinoma after edger standardization, of which 241 were upregulated and 294 were downregulated (| log2 (foldchange) | = 1andpvalue < 0.05). This study shows that high-throughput sequencing technology is helpful for us to determine the expression of tRF & tiRNA in cholangiocarcinoma, and to screen out differentially expressed tRF & tiRNA, and further to explore the factors that affect the progress of cholangiocarcinoma.
2021-10-31 | GSE147017 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Fresh fish are highly perishable food products and their short shelf-life limits their commercial exploitation, leads to waste and has a negative impact on aquaculture sustainability. New non-thermal food processing methods, such as High pressure (HP), are being investigated to prolong shelf-life while assuring high food quality. We applied several tools to evaluate the impacts of HP processing on European sea bass (Dicentrarchus labrax) fillets quality and shelf life. The data here presented includes visual and physical measurements of flesh quality and the microbiome and proteome profiles of control and HP-processed sea bass fillets (600MPa, 25ºC, 5min), after isothermal storage (2°C) for different periods ranging from 1 to 67 days. Color (L-, a- and b- values) change and texture (hardness, cohesiveness and adhesiveness) parameters were obtained by using appropriate colorimeter and texture analyser, respectively, during refrigerated storage. Bacterial diversity was analysed by Illumina high-throughput sequencing of the 16S rRNA gene in five pooled DNAs from control or HP-processed fillets after 1, 11 or 67 days and the raw reads were deposited in the NCBI-SRA database with accession number PRJNA517618. In addition, high-throughput sequencing of the internal transcribed spacer (ITS) region targeting yeast and moulds was run for control or HP-processed fillets at the end of storage (11 or 67 days, respectively), being deposited under SRA accession PRJNA517779. Quantitative label-free proteomics profiles were analysed by SWATH-MS (Sequential Windowed data independent Acquisition of the Total High-resolution-Mass Spectra) in myofibrillar or sarcoplasmic enriched protein extracts pooled for control or HP-processed filets after short (1d) or long-term (11-67 days) storage. These data support the findings reported in “High pressure processing of European sea bass (Dicentrarchus labrax) fillets and tools for flesh quality and shelf life monitoring” (Tsironi et al. 2019).
2019-11-06 | PXD012737 | Pride