Ontology highlight
ABSTRACT:
PROVIDER: PRJNA645045 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Marine prokaryotic community sequencing based on 16S rDNA V4 region Targeted loci environmental
| PRJNA703765 | ENA
Project description:16S rDNA V4 region amplicon sequencing of mice colonic microbiota
| PRJDB4266 | ENA
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
2013-06-25 | GSE42426 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach. Phylogenetic study of the Treponema taxa found in digital dermatitis lesions of Holstein cows.
2013-06-25 | E-GEOD-42426 | biostudies-arrayexpress
Project description:Opioids such as morphine have many beneficial properties as analgesics, however, opioids may induce multiple adverse gastrointestinal symptoms. We have recently demonstrated that morphine treatment results in significant disruption in gut barrier function leading to increased translocation of gut commensal bacteria. However, it is unclear how opioids modulate the gut homeostasis. By using a mouse model of morphine treatment, we studied effects of morphine treatment on gut microbiome. We characterized phylogenetic profiles of gut microbes, and found a significant shift in the gut microbiome and increase of pathogenic bacteria following morphine treatment when compared to placebo. In the present study, wild type mice (C57BL/6J) were implanted with placebo, morphine pellets subcutaneously. Fecal matter were taken for bacterial 16s rDNA sequencing analysis at day 3 post treatment. A scatter plot based on an unweighted UniFrac distance matrics obtained from the sequences at OTU level with 97% similarity showed a distinct clustering of the community composition between the morphine and placebo treated groups. By using the chao1 index to evaluate alpha diversity (that is diversity within a group) and using unweighted UniFrac distance to evaluate beta diversity (that is diversity between groups, comparing microbial community based on compositional structures), we found that morphine treatment results in a significant decrease in alpha diversity and shift in fecal microbiome at day 3 post treatment compared to placebo treatment. Taxonomical analysis showed that morphine treatment results in a significant increase of potential pathogenic bacteria. Our study shed light on effects of morphine on the gut microbiome, and its role in the gut homeostasis.
2018-04-16 | E-MTAB-5546 | biostudies-arrayexpress
Project description:Fecal samples collected on day 5 from randomly selected colitic SD rats were analyzed for gut microbiota by sequencing the V4 region of the 16S rRNA gene. The orally administered Dex-P-laden NPA2 coacervate (Dex-P/NPA2) significantly restores the diversity of gut microbiota compared with colitic SD rats in the Dex-P/PBS group and the untreated colitic rats (Control).
2021-11-06 | GSE167138 | GEO
Project description:Fecal samples Illumina MiSeq 16S rRNA sequencing, V4 hypervariable region
| EGAD00001004106 | EGA