Ontology highlight
ABSTRACT:
PROVIDER: PRJNA649422 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Bisulfite conversion and whole genome-single base next generation sequencing of DNA from a single iPSC clone (CMC28). This method provides exceptional depth of the sequenced methylome. Bisulfite converted DNA from a single iPSC clone (CMC28), and get its high-throughput sequence data with Illumina.
2011-02-12 | E-GEOD-27239 | biostudies-arrayexpress
Project description:We report the m6dA modification on the Drosophila genome. We collected ovary genomic DNA from 2-day wild-type and DMAD mutant files and performed DNA-immunoprecipitation(DNA-IP)experiments using anti-m6dA antibody. The generated DNA library was subjected to a high-throughput deep sequencing analysis. In this assay, the IgG-immunoprecipited DNA from the same amount of wild-type ovaries was used as the control, and the high-throughput sequencing resulted in a range of approximately 3 to 4.6 million reads. In sum, we identified 50 and 195 peaks from wild-type and DMAD mutant samples. Importantly, m6dA is mainly utilized to modify the transposon sequence on the chromosomes. Examination of m6dA modifications in Genomic DNA of WT and DMAD mutant ovary.
2016-06-01 | E-GEOD-64340 | biostudies-arrayexpress
Project description:We use nucleosome maps obtained by high-throughput sequencing to study sequence specificity of intrinsic histone-DNA interactions. In contrast with previous approaches, we employ an analogy between a classical one-dimensional fluid of finite-size particles in an arbitrary external potential and arrays of DNA-bound histone octamers. We derive an analytical solution to infer free energies of nucleosome formation directly from nucleosome occupancies measured in high-throughput experiments. The sequence-specific part of free energies is then captured by fitting them to a sum of energies assigned to individual nucleotide motifs. We have developed hierarchical models of increasing complexity and spatial resolution, establishing that nucleosome occupancies can be explained by systematic differences in mono- and dinucleotide content between nucleosomal and linker DNA sequences, with periodic dinucleotide distributions and longer sequence motifs playing a secondary role. Furthermore, similar sequence signatures are exhibited by control experiments in which genomic DNA is either sonicated or digested with micrococcal nuclease in the absence of nucleosomes, making it possible that current predictions based on highthroughput nucleosome positioning maps are biased by experimental artifacts.
2010-08-20 | GSE23712 | GEO
Project description:We report the application of single-molecule-based sequencing technology for high-throughput profiling of HePG2i cell line with and without DOX induced GATA4 expression by obtaining over four billion bases of sequence from chromatin immunoprecipitated DNA.
2019-08-13 | GSE135714 | GEO
Project description:We use nucleosome maps obtained by high-throughput sequencing to study sequence specificity of intrinsic histone-DNA interactions. In contrast with previous approaches, we employ an analogy between a classical one-dimensional fluid of finite-size particles in an arbitrary external potential and arrays of DNA-bound histone octamers. We derive an analytical solution to infer free energies of nucleosome formation directly from nucleosome occupancies measured in high-throughput experiments. The sequence-specific part of free energies is then captured by fitting them to a sum of energies assigned to individual nucleotide motifs. We have developed hierarchical models of increasing complexity and spatial resolution, establishing that nucleosome occupancies can be explained by systematic differences in mono- and dinucleotide content between nucleosomal and linker DNA sequences, with periodic dinucleotide distributions and longer sequence motifs playing a secondary role. Furthermore, similar sequence signatures are exhibited by control experiments in which genomic DNA is either sonicated or digested with micrococcal nuclease in the absence of nucleosomes, making it possible that current predictions based on highthroughput nucleosome positioning maps are biased by experimental artifacts. Included are raw (eland) and mapped (wig) reads. The mapped reads are provided in eland and wiggle formats, and the raw reads are included in the eland file. This series includes only Mnase control data. The sonicated control is part of this already published accession, as is a in vitro nucleosome map: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE15188 We also studied data (in vitro and in vivo maps as well as a model) from http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13622 and from: http://www.ncbi.nlm.nih.gov/sra/?term=SRA001023
2010-08-20 | E-GEOD-23712 | biostudies-arrayexpress
Project description:We report the sequences bound to CENP-A in the dog genome (Canis familiaris) for high-throughput characterization of centromeric sequences. We compare these ChIPSeq reads (72 bp, single read) against a reference centromeric satellite DNA domain database for the dog genome, resulting in the annotation of sequence variation and estimated abundance of seven satellite families together with adjacent, non-satellite sequences. To study global patterns of sequence diversity and characterizing the subset of sequences correlated with centromere function, these sequences were evaluated relative to a comprehensive centromere sequence domain k-mer library. From this analysis, we identify functional sequence features from two satellite families (CarSat1 and CarSat2) that are defined by distinct arrays subtypes. Sequences bound to CENP-A in MDCK (dog) cell line
2012-07-23 | E-GEOD-38079 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:We report the application of single-molecule-based sequencing technology for high-throughput profiling of WRKY63 in 10 days old pro::WRKY63:GFP arabidopsis. By obtaining sequence from chromatin immunoprecipitated DNA, we mapped genome-wide binding levels of WRKY63:GFP. ChIP was performed using anti-GFP antibody (ab290), and ChIP DNA were analyzed by Illumina NovoSeq.
2022-09-13 | GSE177884 | GEO
Project description:We report the application of single-molecule-based sequencing technology for high-throughput profiling of KYP in 10 days old KYPpro::KYP:3xFLAG arabidopsis. By obtaining sequence from chromatin immunoprecipitated DNA, we mapped genome-wide binding levels of KYP:3xFLAG. ChIP was performed using anti-FLAG antibody (sigma M2), and ChIP DNA were analyzed by Illumina NovoSeq.
2023-03-01 | GSE195735 | GEO
Project description:Accurate predictions of the DNA binding specificities of transcription factors (TFs) are necessary for understanding gene regulatory mechanisms. Traditionally, predictive models are built based on nucleotide sequence features. Here, we employed three- dimensional DNA shape information obtained on a high-throughput basis to integrate intuitive DNA structural features into the modeling of TF binding specificities using support vector regression. We performed quantitative predictions of DNA binding specificities, using the DREAM5 dataset for 65 mouse TFs and genomic-context protein binding microarray data for three human basic helix-loop-helix TFs. DNA shape-augmented models compared favorably with sequence-based models for these predictions. Although both k-mer and DNA shape features encoded the interdependencies between nucleotide positions of the binding site, using DNA shape features reduced the dimensionality of the feature space compared to k-mer use. Finally, analyzing the weights of DNA shape-augmented models uncovered TF family- specific structural readout mechanisms that were not obvious from the nucleotide sequence.
2014-11-04 | GSE59845 | GEO