Ribosome profiling in DDX3X degron cell lines and covering variants
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA660002 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Ribosome profiling in DDX3X degron cell lines and complementation with sex-linked paralogs
| PRJNA749053 | ENA
Project description:We describe the subset of transcripts that require DDX3 for efficient translation.
2020-09-30 | GSE157063 | GEO
Project description:Structural characterization of ribosome variants
| PRJNA414663 | ENA
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
2022-04-06 | GSE190507 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59095 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59093 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59094 | GEO
Project description:The X-linked DDX3X gene encodes an ATP-dependent DEAD-box RNA helicase frequently altered in various human cancers including melanomas. Despite its important roles in translation and splicing, how DDX3X dysfunction specifically rewires gene expression in melanoma remains completely unknown. Here we uncover a DDX3X-driven post-transcriptional program that dictates melanoma phenotype and poor disease prognosis. Through an unbiased analysis of translating ribosomes we identified the microphtalmia-associated transcription factor, MITF, as a key DDX3X translational target that directs a proliferative-to-metastatic phenotypic switch in melanoma cells. Mechanistically, DDX3X controls MITF mRNA translation via an internal ribosome entry site (IRES) embedded within the 5’ untranslated region. Through this exquisite translation-based regulatory mechanism, DDX3X steers MITF protein levels dictating melanoma metastatic potential in vivo and response to targeted therapy. Together these findings unravel a post-transcriptional layer of gene regulation that may provide a unique therapeutic vulnerability in aggressive male melanomas.
2019-05-17 | GSE131343 | GEO
Project description:We describe the subset of transcripts that require DDX3 for efficient translation and identify similarities and differences between X- and Y- linked paralogs of DDX3.
2021-11-24 | GSE180669 | GEO
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
2023-03-31 | GSE201967 | GEO