Fecal sample
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA669266 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:To further identify the fecal miRNAs generated in HE, we conducted an miRNA microarray analysis on feces collected from patients with HE and CHB. The microarray analysis of miRNA expression profiles revealed that the abundance of 10 miRNAs was significantly increased in feces from patients with HE, as compared with that from patients with CHB, whereas the abundance of 8 miRNAs was decreased.
2023-04-19 | GSE228731 | GEO
Project description:Microbiota dysbiosis has been reported to contribute to the pathogenesis of colitis, to demonstrate whether IL-17D protects against DSS-induced colitis through regulation of microflora, we performed 16S rRNA sequencing in feces from WT and Il17d-deficient mice. Our data indicate that Il17d deficiency results in microbiota dysibiosis in both steady state and DSS-induced colitis.
2021-05-20 | GSE165789 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Alterations in intestinal microbiota and intestinal short chain fatty acids profiles have been associated with the pathophysiology of obesity and insulin resistance. Whether intestinal microbiota dysbiosis is a causative factor in humans remains to be clarified We examined the effect of fecal microbial infusion from lean donors on the intestinal microbiota composition, glucose metabolism and small intestinal gene expression. Male subjects with metabolic syndrome underwent bowel lavage and were randomised to allogenic (from male lean donors with BMI<23 kg/m2, n=9) or autologous (reinfusion of own feces, n=9) fecal microbial transplant. Insulin sensitivity and fecal short chain fatty acid harvest were measured at baseline and 6 weeks after infusion. Intestinal microbiota composition was determined in fecal samples and jejunal mucosal biopsies were also analyzed for the host transcriptional response. Insulin sensitivity significantly improved six weeks after allogenic fecal microbial infusion (median Rd: from 26.2 to 45.3 μmol/kg.min, p<0.05). Allogenic fecal microbial infusion increased the overall amount of intestinal butyrate producing microbiota and enhanced fecal harvest of butyrate. Moreover, the transcriptome analysis of jejunal mucosal samples revealed an increased expression of genes involved in a G-protein receptor signalling cascade and subsequently in glucose homeostasis. Lean donor microbial infusion improves insulin sensitivity and levels of butyrate-producing and other intestinal microbiota in subjects with the metabolic syndrome. We propose a model wherein these bacteria provide an attractive therapeutic target for insulin resistance in humans. (Netherlands Trial Register NTR1776).
2020-10-28 | GSE30854 | GEO
Project description:Complex oligosaccharides found in human milk play a vital role in gut microbiome development for the human infant. Bovine milk oligosaccharides (BMO) have similar structures with those derived from human milk, but have not been well studied for their effects on the healthy adult human gut microbiome. Healthy human subjects consumed BMO over two-week periods at two different doses and provided fecal samples. Metatranscriptomics of fecal samples was conducted to determine microbial and host gene expression in response to the supplement. Fecal samples were also analyzed by mass spectrometry to determine levels of undigested BMO. No changes were observed in microbiome activity across all participants. Repeated sampling enabled subject-specific analyses: four of six participants had minor, yet statistically significant, changes in microbial activity. No significant change was observed in the gene expression of host cells in stool. Levels of BMO excreted in feces after supplementation were not significantly different from placebo and were not correlated with dosage or expressed microbial enzyme levels. Collectively, these data suggest that BMO is fully digested in the human gastrointestinal tract prior to stool collection. Participants’ gut microbiomes remained stable but varied between individuals. Additionally, the unaltered host transcriptome provides further evidence for the safety of BMO as a dietary supplement or food ingredient.
2020-02-18 | GSE108809 | GEO
Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.
2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress