Manipulation of Mir140 3p and 5p expression
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA681217 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The goal of this study was to change the stoichiometry of Mir140-3p and Mir140-5p expression, thereby increasing the expression levels of Mir140-5p, and observe the biological effects on skeletal development. This was done by introducing two types of nucleotide changes into the seed regions of Mir140. The first was by changing the initial bases of Mir140-3p from 'TACCACAGGGTAGAACCACGGACAGGGTACTGGAGC' to 'CGCCACAGGGTAGAACCACGGACAGGGTACTGGAGC' lowering the expression levels of Mir140 3p and disrupting its function. The second change to alter Mir140 expression was by changing the Mir140-5p seed region from 'CAGTGGTTTTACCCTATGGAGG' to 'TAGTGGTTTTACCCTATGGAGG' increasing mi140-5p's ability to be bound by Argonaute.
2020-11-28 | GSE162266 | GEO
Project description:This is a prospective-retrospective study to determine if the expression of the miRNA’s miR-31-3p and miR-31-5p are prognostic of patient outcomes or predictive of the benefit from anti-EGFR therapy in stage III Colon Cancer. The present study will utilize FFPE tumor samples collected from patients enrolled in the PETACC-8 study conducted by the Fédération Francophone de Cancérologie Digestive (FFCD). This phase 3 clinical trial prospectively randomized fully resected stage III colon cancer patients to receive adjuvant treatment with either FOLFOX-4 plus cetuximab or FLOFOX-4 alone.
| 2260465 | ecrin-mdr-crc
Project description:In our previous study, hsa-let-7d-3p, hsa-let-7e-5p,hsa-miR-146a-5p,hsa-miR-130a-3p, hsa-miR-151a-3p,were significantly upregulated in the plasma of atopic patients. To study the each function of let-7d-3p, let-7e-5p,miR-146a-5p,miR-130a-3p, miR-151a-3p which are significantly upregulated in the plasma of atopic patients, we performed mimic-transfected THP-1 cells, a mononuclear cell line, and performed comprehensive genetic analysis.
2023-02-06 | GSE217971 | GEO
Project description:Whole transcriptome Identification of direct targets of miR-199a-5p and miR-424-3p using biotinylated pull-downs found that both miRNAs are likely to have a role in the cell cycle. HEK293T cells were transfected with biotinylated miRNAs (either miR-199a-5p or miR-424-3p). The miRNAs and target mRNA were pulled down with streptavidin and compared to the input control.
2013-12-02 | E-GEOD-40406 | biostudies-arrayexpress
Project description:RNA-sequencing was performed to gain insight into the transcriptome-wide molecular changes induced by miR-30a-5p or miR-30a-3p over-expression in lung adenocarcinoma cells. Following transfection of miR-30a-5p or miR-30a-3p miRNA mimic or control RNA, RNA-sequencing was performed. This high-throughput data revealed elevated expression of both miR-30a-5p and miR-30a-3p reduced the expression of genes and pathways known to induce proliferation and movement in lung adenocarcinoma cells.
2020-02-26 | GSE142695 | GEO
Project description:To identify target genes of miR-142-5p and miR-130a-3p that are involved in M2 polarization, we examined the mRNA expression profile changes after altering miR-142-5p or miR-130a-3p expression in IL-4-treated macrophages. Macrophages were transfected with control ASO, miR-142-5p ASO, control mimics or miR-130-3p mimics using lentiviral vectors. After 24 hr, the cells were treated with IL-4 for 24h.mRNA was purified from total RNA after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre). Then, each sample was amplified and transcribed into fluorescent cRNA along the entire length of the transcripts without 3’ bias utilizing a random priming method. The labeled cRNAs were hybridized onto the Human RNA Array v2.0 (8 x 60K, Arraystar). After having washed the slides, the arrays were scanned by the Agilent Scanner G2505B.
2014-07-12 | E-GEOD-59347 | biostudies-arrayexpress
Project description:To identify target genes of miR-142-5p and miR-130a-3p that are involved in M2 polarization, we examined the mRNA expression profile changes after altering miR-142-5p or miR-130a-3p expression in IL-4-treated macrophages.
2014-07-12 | GSE59347 | GEO
Project description:Rationale: Currently, there are no blood-based biomarkers with clinical utility for acute ischemic stroke (IS). microRNAs (miRNAs) show promise as disease markers due to their cell-type specific expression patterns and stability in peripheral blood. Objective: To identify circulating miRNAs associated with acute IS, determine their temporal course up to 90 days post-stroke, and explore their utility as an early diagnostic marker. Methods and Results: We used RNA sequencing to study expression changes of circulating miRNAs in a discovery sample of 20 IS patients and 20 matched healthy control subjects (HCs). We further applied qRT-PCR in independent samples for validation (40 IS patients and 40 matched controls), replication (200 IS patients, 100 HCs), and in 72 patients with transient ischemic attacks (TIA). Sampling of patient plasma was done immediately upon hospital arrival. We identified, validated, and replicated three differentially expressed miRNAs, which were upregulated in IS patients compared to both HCs (miR-125a-5p [1.8-fold; P=1.5x10-6], miR-125b-5p [2.5-fold; P=5.6x10-6], and miR-143-3p [4.8-fold; P=7.8x10-9]) and TIA patients (miR-125a-5p: P=0.003, miR-125b-5p: P=0.003, miR-143-3p: P=0.005). Longitudinal analysis of expression levels up to 90 days after stroke revealed a normalization to control levels for miR-125b-5p and miR-143-3p starting at day two, while miR-125a-5p remained elevated. Levels of all three miRNAs depended on platelet numbers in a platelet spike-in experiment, but were unaffected by chemical hypoxia in N2a cells and in experimental stroke models. In a random forest classification, miR-125a-5p, miR-125b-5p and miR-143-3p differentiated between HCs and IS patients with an area under the curve (AUC) of 0.90 (sensitivity: 85.6%; specificity: 76.3%), which was superior to multimodal cranial computed tomography obtained for routine diagnostics (sensitivity: 72.5%) and previously reported biomarkers of acute IS (neuron specific enolase: AUC=0.69, interleukin 6: AUC=0.82). Conclusions: A set of circulating miRNAs (miR-125a-5p, miR-125b-5p, miR-143-3p) associates with acute IS and might have clinical utility as an early diagnostic marker.
2018-02-22 | GSE110993 | GEO
Project description:In our previous study, hsa-let-7d-5p,hsa-miR-27b-3p,hsa-miR-151-5p were significantly upregulated in the plasma of atopic patients. To study the each function of hsa-let-7d-5p,hsa-miR-27b-3p,hsa-miR-151-5p, which are significantly upregulated in the plasma of atopic patients, we performed mimic-transfected THP-1 cells, a mononuclear cell line, and performed comprehensive genetic analysis.
2023-02-06 | GSE217969 | GEO
Project description:We report the application of transcriptome sequencing for investigating of the hsa-miR-371a-5p and hsa-miR-518a-3p regulated genes. JAR, JEG-3 and BeWo choriocarcinoma cells were transfected with hsa-miR-371a-5p or hsa-miR-518a-3p inhibitors or control inhibitors. Totally, 237, 132 and 277 genes with > 2 folds change and adjusted P < 0.05 were upregulated in JAR, JEG-3 and BeWo cells respectively after hsa-miR-371a-5p knockdown. Meanwhile, 229, 269 and 191 genes were upregulated in JAR, JEG-3 and BeWo cells respectively after hsa-miR-518a-3p knockdown. The top upregulated genes included many oncogenes or oncogenesis associated ones. Enrichment analysis showed hsa-miR-371a-5p and hsa-miR-518a-3p regulated diverse pathways related to tumorigenesis and metastasis. Our results would be helpful for the searching of early molecular biomarkers and therapeutic targets for gestational trophoblastic neoplasia.
2018-11-01 | GSE106394 | GEO