Project description:FGFRs regulate PCa development and progression, but the role of the recently found FGFR-like 1 (FGFRL1) remains unclear. The data consists of gene expression profiles of mouse subcutanous xenograft tumors generated of human PC3M prostate cancer cells with stable knockdown of FGFRL1 gene and of the control xenografts.
Project description:FGFRs regulate PCa development and progression, but the role of the recently found FGFR-like 1 (FGFRL1, FGFR5) remains unclear. The data consists of gene expression profiles of FGF13 and FGFRL1 knock-down PC3M prostate cancer cells compared to control cells.
Project description:Analysis of ovarian cancer cell lines after knockdown of FGFRL1 using SiRNA. To elucidate the signaling pathways that were significantly altered following the silencing of FGFRL1 expression, we performed global gene profiling experiments of the OVCAR8 and ES2 cells after knockdown of FGFRL1 using siRNA. We conducted pathway analysis with the differentially expressed genes using R in two OC cells.
Project description:Serine Peptidase Inhibitor, Kazal type 1 (SPINK1) overexpression represents the second-largest prostate cancer (PCa) subtype associated with increased risk of biochemical recurrence and poor prognosis. To determine the pathways regulated by SPINK1 in 22RV1 prostate cancer cells, we performed shRNA mediated knockdown of SPINK1 using lentiviral constructs. Scrambled shRNA was used as a control. pGIPZ constructs against SPINK1 (shSPINK1-1, shSPINK1-2, shSPINK1-3) and control shScrambled construct were purchased from Dharmacon.
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Project description:In order to address the putative role of MELK and UBE2C in prostate cancer development and progression, we performed functional analysis upon siRNA-based knockdown, and searched for downstream genes and processes by microarray experiments. RNAi-based inhibition of MELK and UBE2C was efficient in PC3 prostate cancer cells and decreased transcriptional level down to about 30% remaining expression level. Illumina microarray experiments were done upon siRNA based knockdown 48h after transfection of PC3 cells in triplicates.