Genomics

Dataset Information

0

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells


ABSTRACT: Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

ORGANISM(S): Homo sapiens

PROVIDER: GSE46329 | GEO | 2013/05/10

SECONDARY ACCESSION(S): PRJNA202375

REPOSITORIES: GEO

Similar Datasets

| E-GEOD-46329 | biostudies-arrayexpress
2017-11-01 | GSE85242 | GEO
| E-GEOD-47750 | biostudies-arrayexpress
2018-04-15 | GSE80352 | GEO
2013-03-01 | GSE39355 | GEO
2019-12-16 | GSE124345 | GEO
2013-03-01 | GSE39357 | GEO
2011-04-08 | GSE27914 | GEO
| E-GEOD-39355 | biostudies-arrayexpress
2013-03-01 | GSE39353 | GEO