Browse
Submit Data
Databases
API
Help

Dataset Information

159 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Dataset on fat body proteome of Anopheles stephensi Liston

ABSTRACT: Fat body is an important tissue in the context of vitellogenesis, vector immunity, vector physiology and vector-parasite interaction. However, the proteome of this vital organ has not been investigated in any Anopheline species so far. In this study, we employed multiple fractionation method followed by high resolution mass spectrometry to characterize fat body proteome of female mosquitoes An. stephensi Indian strain. In all, we identified 4, 535 proteins in the fat body and a subset of these proteins were found to be restricted to fat body. Gene ontology analysis of these proteins suggested their role in metabolism, lipid transport, vitellogenesis, mosquito immunity and oxidation-reduction processes. By far, this is the largest proteomic resource of fat body in any mosquito species.

INSTRUMENT(S): LTQ Orbitrap, LTQ Orbitrap Elite

ORGANISM(S): Anopheles Stephensi (asian Malaria Mosquito)

TISSUE(S): Fat Body, Fat Body Cell

DISEASE(S): Disease Free

SUBMITTER: Keshava Prasad T. S.

LAB HEAD: T. S. Keshava Prasad

PROVIDER: PXD006677 | Pride | 2019-01-07

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Publications

Dataset on fat body proteome of Anopheles stephensi Liston.

Kumar Manish M Mohanty Ajeet Kumar AK Dey Gourav G Sreenivasamurthy Sreelakshmi K SK Kumar Ashwani A Prasad Keshava K

Data in brief 20190111

Fat body from Anopheles stephensi female mosquitoes were dissected and processed for proteomic analysis. Both SDS-PAGE and basic Reverse Phase Liquid Chromatography-based fractionation strategies were used to achieve a broad coverage of protein identification. The fractionated peptides were then analyzed on a high-resolution mass spectrometer. Searching the raw data against the protein database of An. stephensi resulted in identification of 4535 proteins, which is, to our knowledge ...[more]

PMID: 30740495

Similar Datasets

Identification of molecular response to blood meal in the fatbody of Anopheles stephensi using quantitative proteomics

Project description:Fat body is an important tissue in the context of vitellogenesis, vector immunity, vector physiology and vector-parasite interaction. However, the proteome of fatbody and impact of blood meal on the gene expression of this vital organ has not been investigated so far. Therefore, in this study, we made an attempt to identify proteins expressed in fatbody of An. stephensi and their altered expression in response to blood meal. In all, we identified 4,504 proteins in the fatbody using multiple fractionation strategies, which is by far the largest resource of fatbody proteome in any mosquito species. Further, comparative proteomic analysis of fatbody 24 and 48 hours post blood meal led to identification of over 300 differentially expressed proteins. Bioinformatics analysis of these proteins suggested their role in vitellogenesis, lipid transport, mosquito immunity and oxidation-reduction processes. Interestingly, we identified four novel genes,which were found to be differentially expressed upon blood meal. These proteins are potential target for vector control strategies and development of transmission blocking vaccines.

2018-01-03 | PXD006462 | Pride

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Mayaro Virus Infection Elicits an Innate Immune Response and Represses Autophagy in Anopheles stephensi

Project description:Mayaro virus (MAYV) is a mosquito-borne Alphavirus responsible for outbreaks in South America and the Caribbean. In this study we infected Anopheles stephensi with MAYV and sequenced mRNA and small RNA to understand how MAYV infection impacts gene transcription and the expression of small RNAs in the mosquito vector. Genes involved with innate immunity and autophagy are regulated in response to MAYV infection of An. stephensi, we also discover novel miRNAs and describe their expression patterns following bloodmeal ingestion. These results suggest that MAYV does induce a molecular response to infection in its mosquito vector species and that MAYV may have mechanisms to evade the vector immune response.

2021-01-26 | GSE165488 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Mosquito-borne diseases and Omics: Tissue-restricted expression and alternative splicing revealed by transcriptome profiling of Anopheles stephensi

Project description:Malaria is as one of the most debilitating mosquito-borne global health burdens. While much of the malaria and mosquito-borne disease attention have focused on Africa, South East Asia accounts for a sizable portion of the malaria global burden. Moreover, about 50% of the Asian malaria incidence and deaths have been from India. The completion of genome sequence of Anopheles stephensi, a major malaria vector in Asia, offers new opportunities for global health innovation, not to mention for progress in deciphering the vectorial ability of this mosquito species at a molecular level. Moving forward, tissue-based expression profiling would be the next obvious step in understanding gene functions of Anopheles stephensi. We report here the first study, to the best of our knowledge, on transcriptomic profile of four important organs of an adult female Anopheles stephensi mosquito (midgut, Malpighian tubules, fat body and ovary). In all, we identified over 21,000 transcripts corresponding to more than 12,000 gene loci from these four tissues. This study provides the tissue-based expression profiles of majority of annotated transcripts in Anopheles stephensi genome, and the dynamics of alternative splicing in these tissues. Understanding the transcript expression and gene function at the tissue level would immensely help in enhancing our knowledge of this important vector and decipher the putative role of these tissues. This knowledge might in turn provide the basis of selection of candidates for future studies on vectorial ability and novel molecular targets to intercept malaria transmission.

2017-06-06 | GSE99679 | GEO

Small RNA and AGO1 CLIP-seq libraries of female Aedes aegypti fat body

Project description:In this work, we aimed to explore miRNA expression and potential targets in the female fat body of the Ae. aegypti mosquito, as well as their changes as a result of blood meal. The fat body is the metabolic center of the insect organism, playing a key role in reproduction. Therefore, understanding of regulatory networks controlling its functions is critical, and the role of miRNAs in the process is largely unknown. Small RNA library analyses revealed four unique miRNA clusters sequentially expressed during the post blood meal (PBM) phase, drawing connections to waves of upstream hormonal signals and gene expression in the same period. To link the miRNA identities with specific downstream targets, transcriptome-wide mRNA 3' UTR interaction sites were experimentally determined at 72 h post eclosion (PE) and 24 h PBM by means of AGO1 CLIP-seq. Hence, the presented manuscript comprehensively elucidated miRNA expression and target dynamics in female mosquito fat body, providing a solid foundation for future functional studies of miRNA regulation during the gonadotrophic cycle.

2017-03-06 | GSE93345 | GEO

Cooler temperatures destabilize RNA interference and increase susceptibility of disease vector mosquitoes to viral infection

Project description:The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus), exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery.

2013-08-13 | GSE46204 | GEO

Human blood microRNAs and their potential effect on mosquitoes

Project description:Blood is a rich source of proteins for mosquitoes, but also contains many other molecules such as microRNAs (miRNAs). Here, we found that human blood miRNAs are transported in abundance into the fat body tissue of Aedes aegypti, a key metabolic center in post-blood feeding reproductive events, where they target and regulate mosquito genes.

2021-06-28 | PXD023190 | Pride

Genome-wide transcriptomic profiling of Anopheles gambiae hemocytes reveals pathogen-specific signatures upon bacterial challenge and Plasmodium berghei infection

Project description:Background: The mosquito Anopheles gambiae is a major vector of human malaria. Increasing evidence indicates that blood cells (hemocytes) comprise an essential arm of the mosquito innate immune response against both bacteria and malaria parasites. To further characterize the role of hemocytes in mosquito immunity, we undertook the first genome-wide transcriptomic analyses of adult female An. gambiae hemocytes following infection by two species of bacteria and a malaria parasite. Results: We identified 4047 genes expressed in hemocytes, using An. gambiae genome-wide microarrays. While 279 transcripts were significantly enriched in hemocytes relative to whole adult female mosquitoes, 959 transcripts exhibited immune challenge-related regulation. The global transcriptomic responses of hemocytes to challenge with different species of bacteria and/or different stages of malaria parasite infection revealed discrete, minimally overlapping, pathogen-specific signatures of infection-responsive gene expression; 105 of these represented putative immunity-related genes including anti-Plasmodium factors. Of particular interest was the specific co-regulation of various members of the Imd and JNK immune signaling pathways during malaria parasite invasion of the mosquito midgut epithelium. Conclusion: Our genome-wide transcriptomic analysis of adult mosquito hemocytes reveals pathogen-specific signatures of gene regulation and identifies several novel candidate genes for future functional studies.

2011-10-31 | GSE33269 | GEO

Effects of hemocyte ablation on fat body gene expression

Project description:To test the contributions of phagocytic immune cells to mosquito immunity, we depleted mosquito phagocytes using clodronate liposomes and then challenged mosquitoes with malaria parasites. Observing a large increase in infection intensity, the purpose of the RNA-seq experiment is to determine their effects of phagocyte depletion on mosquito immunity.

2020-04-10 | GSE116156 | GEO