Neuronal cells from ASL patients
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Q Exactive
ORGANISM(S): Homo Sapiens (human)
TISSUE(S): Multipotent Stem Cell, Cotyledon
SUBMITTER: 
Chiara guerrera
LAB HEAD: GUERRERA Isa Chuara
PROVIDER: PXD020316 | Pride | 2021-05-11
REPOSITORIES: Pride
Similar Datasets
Project description:Regulation of gene expression is essential for normal development and cellular growth. Transcriptional events are tightly controlled both spatially and temporally by specific DNA-protein interactions. In this study we finely map the genome-wide targets of the CREB protein across all known and predicted human promoters, and characterize the functional consequences of a subset of these binding events using high-throughput reporter assays. To measure CREB binding, we used HaloCHIP, an antibody-free alternative to the ChIP method that utilizes the HaloTag fusion protein, and also high-throughput promoter-luciferase reporter assays, which provide rapid and quantitative screening of promoters for transcriptional activation or repression in living cells. CREB ChIP-chip two biologcal replicates. HaloCHIP-chip three biological replicates with and without Forskolin
2010-05-22 | E-GEOD-18347 | biostudies-arrayexpress
Project description:Using Huntington’s disease (HD) mouse models that quantitatively replicate the reduction of striatal Phoshodiesterase 10 (PDE10) levels in manifest Huntington’s disease patients, we demonstrate the potential therapeutic benefit of PDE10 inhibition on correcting basal ganglia circuitry deficits thought to drive disease symptomology in patients. PDE10 inhibition acutely restored corticostriatal input and boosted cortically driven indirect pathway activity in HD models with compromised PDE10 levels. We show that cyclic nucleotide signaling processes are impaired in the models, and that elevation of both the cAMP and cGMP nucleotides afforded by PDE10 inhibition are required for this rescue. Global phosphoproteomic profiling of striatal proteins in response to PDE10 inhibition provide novel information on the plausible neural substrates responsible for the improvement. Finally, we show that long-term chronic treatment of the Q175 knock-in mouse model with PDE10A inhibitors, starting at a presymptomatic age, showed improvements, above and beyond those seen during acute administration, including a partial reversal of striatal deregulated transcripts predominantly driven through activation of the AP-1 and CREB transcription factor complexes, and a prevention of the emergence of some cardinal HD neurophysiological deficits.
2016-12-02 | PXD005138 | Pride
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.
2008-10-25 | E-GEOD-12056 | biostudies-arrayexpress
Project description:Treatment of tumor progression and metastasis continues to be of major importance in the field of cancer. It is reported that cancer cells often show a pronounced sensitivity towards oxidative stress. Cold plasma offers the ability to deliver a delicate mix of reactive oxygen and nitrogen species directly into cells or tissues. Using a well-described argon plasma jet, we investigated the biological responses of plasma on tumor cell death, cell migration, and expression of adhesion-associated genes as well as cytoskeletal modifications. Using the human melanoma cancer cell line SK-Mel-147 we were able to show that plasma induced only little apoptosis but had profound effects on tumor cell motility. Plasma treatment of cells was associated with an inhibition of migration and disorganization of the actin cytoskeleton which were mediated through multiple signaling pathways, as transcriptome-wide gene analysis suggested. Specifically, changes in cell adhesion were regulated by differential expression of cell junction and cell-matrix proteins. These results provide evidence that plasma may be able to disturb the migration and adhesion in metastatic SK-Mel-147 cells. Microarrays were used to analyze and investigate the biological effects of cold plasma on human melanoma cell line SK-Mel-147. Using an argon plasma jet kinpen, regulated transcripts were analyzed and further described in Schmidt et al. (2015): M-bM-^@M-^\Human melanoma cell migration and adhesion is decreased by cold plasma treatmentM-bM-^@M-^]. A study using total RNA recovered from human SK-Mel-147, treated with cold plasma as well as H2O2-treated and untreated SK-Mel-147 controls.
2015-02-18 | E-GEOD-65972 | biostudies-arrayexpress
Project description:Exposure to environmental contaminants like nonylphenol can disrupt smolt development and may be a contributing factor in salmon population declines. We used GRASP 16K cDNA microarrays to identify genes that are differentially expressed in the liver, gill, hypothalamus, pituitary, and olfactory rosettes of Atlantic salmon smolts treated with nonylphenol compared to control smolts. Nonylphenol treatment was confirmed using physiological assays: nonylphenol-treatment significantly decreased gill Na+,K+-ATPase activity and plasma cortisol and T3 levels. Microarray analyses were used to compare expression in nonylphenol-injected fish with expression in vehicle-injected fish: eight arrays each for liver, gill, olfactory rosettes, hypothalamus, and pituitary tissues. Total RNA was isolated from the tissues of eight nonylphenol-injected fish (six males and two females) and eight vehicle-injected fish (two males and six females) and reverse transcribed separately (not pooled); each slide represents a biological replicate. For each tissue, the eight arrays were balanced for dye: nonylphenol-injected fish were labeled with Alexa Fluor 555 and vehicle-injected fish were labeled with Alexa Fluor 647 on four slides, nonylphenol-injected fish were labeled with Alexa Fluor 647 and vehicle-injected fish were labeled with Alexa Fluor 555 on four slides. Liver, gill, hypothalamus, pituitary, and olfactory rosette tissues were analyzed separately.
2012-06-03 | E-GEOD-33715 | biostudies-arrayexpress
Project description:CRTC2 is a critical transcription cofactor that induces the glucose homeostatic genes by activating CREB. However, energy homeostasis is maintained by multiple pathways, therefore, it is possible that CRTC2 may interact with other transcription factors, especially under metabolic stress. Thereby, CRTC2 liver-specific knockout mice were created and the global proteome, phosphoproteome and acetylome from liver tissue under the high fat diet conditions were analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) and bioinformatics analysis. As expected, differentially expressed proteins (DEPs) are enriched in metabolic pathways that were subsequently corroborated by animal experiments. The consensus DEPs from these datasets were used as seed proteins to generate a protein-protein interaction (PPI) network using STRING and GeneMANIA identified fatty acid synthase (FASN) as the mutually relevant protein. Additional local-PPI (LPPI) analysis of CRTC2 and FASN with DEPs, SREBF1 was found to be a common mediator. CRTC2/CREB and SREBF1 are transcription factors, DNA-binding motif analysis showed multiple CRTC2/CREB regulated genes also possess SREBF1 binding motifs that unveil the possible induction by CRTC2/SREBF1 complex, which is reinforced by structural analysis. Thus, CRTC2/SREBF1 complex plausibly modulate the transcription of multiple proteins that fine-tune the cellular metabolism under metabolic stress.
2023-10-24 | PXD039817 | Pride
Project description:We tried to find the target genes of miR-100 in MGC-803 and SK-BR-3 cells, thus we uesd specific miR-100 inhibitor to knock down the level of miR-100 in the cells, with this condition, we used this mRNA microarray to find the genes whose amount changed. and they may be the target genes that miR-100 mediated. Total of four chips, MGC-AMO, MGC-NC, SK-AMO, SK-NC. MGC and SK represents MGC-803 and SK-BR-3 cells respectively. AMO is the specific miR-100 inhibitor and NC is negative control.
2014-01-09 | E-GEOD-53909 | biostudies-arrayexpress
Project description:Introduction: In breast cancers, the basal-like subtype has high levels of genomic instability relative to other breast cancer subtypes with many basal-like-specific regions of aberration. There is evidence that this genomic instability extends to smaller scale genomic aberrations as well, as shown by a previously described micro-event in the PTEN gene in the Basal-like SUM149 breast cancer cell line. Methods: We sought to identify if small regions of genomic change exist by using a high density, gene centric Comparative Genomic Hybridizations (CGH) array on both cell lines and primary tumors. A custom Agilent tiling array for CGH (244,000 probes, 200bp tiling resolution) was created to identify small regions of genomic change and was focused on previously identified basal-like-specific, and general cancer genes. Tumor genomic DNA from 94 patients and 2 breast cancer cell lines was labeled and hybridized to these arrays. Aberrations were called using SWITCHdna and the smallest 25% of SWITCHdna-defined genomic segments being called micro-aberrations (<64 contiguous probes, ~ <15kb). Results: Our data showed that primary tumor breast cancer genomes frequently contained areas of small-scale copy number gains and losses, termed micro-aberrations, which are undetectable using lower-density genome-wide platforms. The basal-like subtype exhibited the highest incidence of these events. These micro-aberrations sometimes altered expression of the involved gene as suggested by data from microarray and mRNA-seq studies. We confirmed the presence of the PTEN micro-amplification in SUM149 and by mRNA-seq showed that this resulted in loss of expression of all exons downstream of this event. Micro-aberrations disproportionately affected the 5’ regions of the affected genes, including the promoter region, and a high frequency of micro-aberrations was associated with poor survival outcomes. Conclusion: Using a high probe density, gene-centric aCGH microarray, we present evidence of small-scale genomic aberrations that contribute to gene inactivation, and thus, genomic instability and tumor formation through a mechanism not detected using conventional copy number analyses. reference x sample
2013-04-22 | E-GEOD-36889 | biostudies-arrayexpress
Project description:The impact of low-dose ionizing radiation (IR) on human brain has recently attracted attention due to increased use of IR for diagnostic purposes. The aim of this study was to investigate low-dose radiation response in hippocampus. Female C57Bl/6 mice were irradiated with 0 (control), 0.063, 0.125 or 0.5 Gy and quantitative label-free proteomic analysis of hippocampus was performed after 24 months. Key pathways were validated by immunoblotting. CREB signaling and CREB-associated pathways were the most affected ones at all doses. The two lower doses seemed to induce CREB pathway, whereas the exposure to 0.5 Gy deactivated CREB. Similarly, the lowest dose (0.063 Gy) was anti-inflammatory reducing the number of activated microglia (IBA1), whilst induction of activated microglia and reactive astroglia (GFAP) was found at 0.5 Gy suggesting increased inflammation and astrogliosis, respectively. Apoptotic markers BAX and cleaved CASP-3 and oxidative stress markers (carbonylation, NRF-2) were increased only at the highest dose. Since activated CREB pathway plays a central role in learning and memory, these data suggest neuroprotection at the lowest dose (0.063 Gy) but neurodegeneration at 0.5 Gy. These effects become significant only in old animals (24 m) and support the hypothesis of radiation-induced accelerated aging in the brain.
2019-11-06 | PXD015729 | Pride
Project description:Several studies have shown the importance of immune and inflammatory mediators in the pathogenesis of heart failure. In clinical practice has been observed that many conventional drugs can modulate circulating levels of these mediators. Despite, there is poor understanding of the precise mechanisms of these drugs in regulating immune and inflammatory systems. Blood monocytes were isolated from 6 hospitalized patients in Intensive Cardiology Care Unit (ICCU) with symptomatic acute congestive heart failure (ACHF) (NYHA Class III-IV) before and after treatment with conventional drugs (ARBs, ACEIs, diuretics, and beta-blockers). Gene expression analysis (n=11) using whole human genome microarray showed that pharmacological treatment abrogate inflammatory activation of monocytes. The inflammatory response network constructed with Ingenuity Pathway Analysis (IPA) indicates the M-bM-^@M-^\TNFR1 signalingM-bM-^@M-^] as the most significantly modulated after pharmacological treatment and the pro-inflammatory cytokine TNF-alpha associated with more than a fifth of genes considered. In this study, we analyzed the expression profiles of 6 biological replicates of blood monocytes from ACHF patients pre- and post-treatment with conventional drugs (ARBs, ACEIs, diuretics, and beta-blockers). All RNAs from pre-treatment monocytes were hybridized against RNAs from post-treatment RNAs. We performed a total of 11 technical replicates.
2013-10-31 | E-GEOD-51888 | biostudies-arrayexpress