Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

DDX3X associated proteins with or without circRIG-I

ABSTRACT: We use FLAG pulldown assay to find DDX3X associated proteins with or without circRIG-I in HEK293T.

INSTRUMENT(S):

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Kidney

SUBMITTER: Jia Song

LAB HEAD: Dan Lu

PROVIDER: PXD037929 | Pride | 2022-11-16

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	S1.raw	Raw
	S2.raw	Raw
	S3.raw	Raw
	SEARCH.zip	Other

Items per page:

1 - 4 of 4

Similar Datasets

circRIG-I associated proteins in HEK293T

Project description:We use Proximity biotinylation to find circRIG-I associated proteins in HEK293T.

2022-11-16 | PXD037928 | Pride

Mass spectrometry analysis of VHL and BICD2 binding protein in HEK-293t cells

Project description:In order to identify the binding proteins of VHL and BICD2, we enriched their binding proteins by TurboID-based proximity labeling technology and Flag pull-down assay, and performed mass spectrum analysis.

2023-10-24 | PXD042830 | Pride

Sex specific pertubations of neuronal development caused by mutations in the autism risk gene DDX3X

Project description:DDX3X is an X-linked RNA helicase that escapes X chromosome inactivation and is expressed at higher levels in female brains. Mutations in DDX3X are associated with intellectual disability (ID) and autism spectrum disorder (ASD) and are predominantly identified in females. Using cellular and mouse models, we show that Ddx3x mediates sexual dimorphisms in brain development at a molecular, cellular, and behavioral level. During cortical neuronal development, Ddx3x sustains a female-biased signature of enhanced ribosomal biogenesis and mRNA metabolism. Compared to male neurons, female neurons display larger nucleoli, higher expression of a set of ribosomal proteins, and a higher cytoplasm-to-nucleus ratio of ribosomal RNA. All these sex dimorphisms are obliterated by Ddx3x loss. Ddx3x regulates dendritic arborization complexity in a sex- and dose-dependent manner in both female and male neurons. Ddx3x regulates the development of dendritic spines but only in female neurons. Further, ablating Ddx3x conditionally in forebrain neurons is sufficient to yield sex-specific changes in developmental outcomes and motor function. Together, these findings pose Ddx3x as a mediator of sexual differentiation during neurodevelopment and open new avenues to understand sex differences in health and disease.

2025-05-26 | PXD060033 | Pride

DUSP2 dephosphorylates STAT3 at Y705 and S727 residues

Project description:In the related study, to determine whether DUSP2 definitively served as a phosphatase for STAT3, an in vitro phosphatase assay was used. Using S-tag beads, p-STAT3 was pulled down from IL-6 stimulated HEK293T cells transfected with STAT3-S-Tag. DUSP2 or control protein, which was purified from HEK293T cells transfected with DUSP2-FLAG or empty vector through extraction with anti-FLAG beads and elution with FLAG peptides, were incubated with p-STAT3-S-Tag-beads in phosphatase buffer. Then bound proteins were eluted and subjected to MS analysis. When compared with the control, incubation of STAT3 and DUSP2 led to dephosphorylation of two STAT3 residues that have been reported to promote its activity, namely tyrosine 705 and serine 727.

2015-10-13 | PXD002743 | Pride

Medulloblastoma associated DDX3X mutants restore malignant potential of medulloblastoma cells decreased upon the loss of DDX3X expression

Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.

2023-03-31 | GSE201967 | GEO

Identification of RPA1 interactome in mouse liver tissue

Project description:To examine the molecular mechanisms by which RPA1 regulates transcription in liver, we conducted immunoprecipitation followed by mass spectrometry to characterize RPA1-associated proteins in mouse liver.

2022-07-19 | PXD021529 | Pride

Sexually dimorphic RNA helicases DDX3X and DDX3Y differentially regulate hollow condensates of DDX3X disease variants

Project description:The sex chromosome-encoded RNA helicases DDX3X and DDX3Y play important roles in RNA metabolism. Heterozygous mutations of DDX3X frequently occur in cancers and neurodevelopmental disorders which have strong sex biases. However, how different DDX3X variants impair cellular function in sex specific genetic background is not understood. Herein, we found that DDX3X variants with significantly impaired ATPase activities demixed into the shells of unique hollow condensates, the dynamics of which were further differentiated by the RNA binding affinities of the different DDX3X variants. Proteomic and imaging studies revealed that DDX3X variant condensates sequestered wild-type DDX3X, DDX3Y, and other proteins important for various signaling pathways. Intriguingly, wild-type DDX3X improved the dynamics of heterogenous variant/wild-type hollow condensates more than DDX3Y. These results suggest that DDX3X variants with distinct enzymatic and condensation propensities may interact uniquely with wild-type DDX3X or DDX3Y to cause sex-specific cellular impacts.

2022-11-26 | MSV000090789 | MassIVE

Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).

Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.

2022-04-06 | GSE190507 | GEO

DDX3X regulation of global translation is impaired by medulloblastoma-associated mutations [RiboSeq]

Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.

2016-05-20 | GSE59095 | GEO

DDX3X suppresses neural lineage susceptibility to medulloblastoma [RNA-seq]

Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.

2020-03-19 | GSE147178 | GEO