DDX3X associated proteins with or without circRIG-I
Ontology highlight
ABSTRACT:
INSTRUMENT(S): LTQ Orbitrap
ORGANISM(S): Homo Sapiens (human)
TISSUE(S): Kidney
SUBMITTER: 
Jia Song
LAB HEAD: Dan Lu
PROVIDER: PXD037929 | Pride | 2022-11-16
REPOSITORIES: Pride
Similar Datasets
Project description:In order to identify the binding proteins of VHL and BICD2, we enriched their binding proteins by TurboID-based proximity labeling technology and Flag pull-down assay, and performed mass spectrum analysis.
2023-10-24 | PXD042830 | Pride
Project description:We use Proximity biotinylation to find circRIG-I associated proteins in HEK293T.
2022-11-16 | PXD037928 | Pride
Project description:In the related study, to determine whether DUSP2 definitively served as a phosphatase for STAT3, an in vitro phosphatase assay was used. Using S-tag beads, p-STAT3 was pulled down from IL-6 stimulated HEK293T cells transfected with STAT3-S-Tag. DUSP2 or control protein, which was purified from HEK293T cells transfected with DUSP2-FLAG or empty vector through extraction with anti-FLAG beads and elution with FLAG peptides, were incubated with p-STAT3-S-Tag-beads in phosphatase buffer. Then bound proteins were eluted and subjected to MS analysis. When compared with the control, incubation of STAT3 and DUSP2 led to dephosphorylation of two STAT3 residues that have been reported to promote its activity, namely tyrosine 705 and serine 727.
2015-10-13 | PXD002743 | Pride
Project description:To examine the molecular mechanisms by which RPA1 regulates transcription in liver, we conducted immunoprecipitation followed by mass spectrometry to characterize RPA1-associated proteins in mouse liver.
2022-07-19 | PXD021529 | Pride
Project description:Stress granules are dynamic cytoplasmic ribonucleoprotein granules that assemble in response to cellular stress. Aberrant formation of stress granules has been linked to neurodegenerative diseases. However, the molecular mechanisms underlying the initiation of stress granules remain elusive. Here we report that the brain-enriched protein kinase FAM69C promotes stress granule assembly through phosphorylation of eukaryotic translation initiation factor 2 (eIF2α). FAM69C physically interacts with eIF2α and functions as a stress-specific kinase for eIF2α, leading to stress-induced protein translation arrest and stress granule assembly. Primary microglia derived from Fam69c knockout mice exhibit aberrant stress granule assembly in response to oxidative stress and ATP. Defective stress granule assembly in microglia correlates with the formation of ASC specks and NLRP3 inflammasome activation, whereas induction of stress granule precludes inflammasome formation. Consistently, increased NLRP3 levels, caspase-1 cleavage and Il18 expression corroborate microglia-associated neuroinflammation in aged Fam69c knockout mice. Our study demonstrates that FAM69C is critical for stress granule assembly and suggests its role in the regulation of microglia function.
2023-04-21 | PXD037697 | Pride
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
2023-03-31 | GSE201967 | GEO
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
2022-04-06 | GSE190507 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59095 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147069 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147178 | GEO