Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities. 9 Biological and 3 technical replicates were evaluated, as well as potential to recover qPCR-defined ratios of DNA, in 454 pyrotag sequencing
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
Project description:A phylogenetic microarray targeting 66 families described in the human gut microbiota has been developped aud used to monitor the gut microbiota's structure and diversity. The microarray format provided by Agilent and used in this study is 8x15K. A study with a total of 4 chips was realized. Arrays 1 and 2: Hybridization with 100ng of labelled 16S rRNA gene amplicons from a mock community sample and 250ng of labelled 16S rRNA gene amplicons from 1 faecal sample. Each Agilent-030618 array probe (4441) was synthetized in three replicates. Arrays 3 and 4: Hybridization with 250ng of labelled 16S rRNA gene amplicons from 2 faecal samples. Each Agilent-40558 array probe (4441) was synthetized in three replicates.