Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Fermentation metagenome

ABSTRACT: 16S amplicon sequence analysis of fermented beverage

PROVIDER: PRJDB4085 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	DRR041850.fastq.gz	Fastqsanger.gz
	DRR041851.fastq.gz	Fastqsanger.gz
	DRR041852.fastq.gz	Fastqsanger.gz
	DRR041853.fastq.gz	Fastqsanger.gz
	DRR041854.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 11

Similar Datasets

fermentation metagenome

Project description:16S amplicon sequence analysis of fermented beverage

| PRJDB4024 | ENA

food fermentation metagenome

Project description:Amplicon sequencing of the fermented grains-16S

| PRJDB8352 | ENA

food fermentation metagenome

Project description:Amplicon sequencing of the fermented grain (16S)

| PRJDB5892 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

food fermentation metagenome

Project description:Amplicon sequencing of the fermented grains and starter-16S

| PRJDB9750 | ENA

food fermentation metagenome

Project description:16S amplicon sequencing of Kishu-narezushi, Japanese traditional fermented sushi

| PRJDB12781 | ENA

Soil metagenome from avocado orchards in Channybearup, Western Australia in 2024

Project description:Metagenome data from soil samples were collected at 0 to 10cm deep from 2 avocado orchards in Channybearup, Western Australia, in 2024. Amplicon sequence variant (ASV) tables were constructed based on the DADA2 pipeline with default parameters.

2025-06-15 | GSE298403 | GEO

food fermentation metagenome

Project description:fermented grains 16S rDNA_V3-V4 Raw sequence reads

| PRJNA386698 | ENA

Analysis of successional diversity in toddy fermentation

Project description:Toddy, a fermented alcoholic beverage Metagenome

| PRJNA610752 | ENA

food fermentation metagenome

Project description:Amplicon sequencing of the fermented grains-ITS

| PRJDB8353 | ENA