Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
Project description:Gas hydrates, also known as clathrates, are cages of ice-like water crystals encasing gas molecules such as methane (CH4). Despite the global importance of gas hydrates, their microbiomes remain mysterious. Microbial cells are physically associated with hydrates, and the taxonomy of these hydrate-associated microbiomes is distinct from non-hydrate-bearing sites. Global 16S rRNA gene surveys show that members of sub-clade JS-1 of the uncultivated bacterial candidate phylum Atribacteria are the dominant taxa in gas hydrates. The Atribacteria phylogeny is highly diverse, suggesting the potential for wide functional variation and niche specialization. Here, we examined the distribution, phylogeny, and metabolic potential of uncultivated Atribacteria in cold, salty, and high-pressure sediments beneath Hydrate Ridge, off the coast of Oregon, USA, using a combination of 16S rRNA gene amplicon, metagenomic, and metaproteomic analysis. Methods were developed to extract bacterial cellular protein from these sediments, as outlined below. Sample Description Three sediments samples were collected from beneath Hydrate Ridge, off the coast of Oregon, USA. Sediments were cored at ODP site 1244 (44°35.1784´N; 125°7.1902´W; 895 m water depth) on the eastern flank of Hydrate Ridge ~3 km northeast of the southern summit on ODP Leg 204 in 2002 and stored at -80°C at the IODP Gulf Coast Repository. E10H5 sediment is from 68.5 meters below sediment surface interface C1H2 sediment is from 2 meters below sediment surface interface. C3H4 sediment is from 21 meters below sediment surface interface.
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.