Project description:Primary outcome(s): Analysis of the diversity and composition of the gut microbiome by 16S rRNA sequencing
Study Design: Observational Study Model : Others, Time Perspective : Prospective, Enrollment : 60, Biospecimen Retention : Collect & Archive- Sample with DNA, Biospecimen Description : Blood, Stool
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles. A total of 56 samples were collected that represent water and sediment samples from 14 sample sites over two different time points (November 18 and 25, 2011).
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
Project description:Sequencing of 16S ribosomal RNA (rRNA) gene, which has improved the characterization of microbial community, has made it possible to detect a low level Helicobacter pylori (HP) sequences even in HP-negative subjects which were determined by a combination of conventional methods. This study was conducted to obtain a cutoff value for HP colonization in gastric mucosa biopsies and gastric juices by the pyrosequencing method. Corresponding author: Department of Internal Medicine, Seoul National University Bundang Hospital, Seoungnam, Gyeonggi-do, Korea; Department of Internal Medicine and Liver Research Institute, Seoul National University College of Medicine, Seoul, Korea (Tel., +82-31-787-7008; e-mail, nayoungkim49@empas.com). Microbial DNA from gastric mucosal samples [gastric antrum (n=63, mucosal biopsy), follow-up sample on gastric antrum (n=16, mucosal biopsy), and gastric body (n=18, mucosal biopsy)] and gastric juices (n=4, not mucosal biopsy) was amplified by nested PCR using universal bacterial primers, and the 16S rRNA genes were pyrosequenced.
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.