Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ChIP-seq data of Jun target genes and the control in zebrafish embryos

ABSTRACT: ChIP-seq data of Jun target genes and the control in zebrafish embryos

PROVIDER: PRJEB20538 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR1943920.fastq.gz	Fastqsanger.gz
	ERR1943921.fastq.gz	Fastqsanger.gz
	ERR1943922.fastq.gz	Fastqsanger.gz
	ERR1943923.fastq.gz	Fastqsanger.gz
	ERR1943924.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

ChIP-seq data of Jun target genes and the control in zebrafish embryos

Project description:The ChIP assay was carried out within the tgf- mutant and sibling embryos at 32 hpf in zebrafish. The sonicated DNA was precipitated by Jun or Normal Rabbit IgG antibodies.

2017-06-08 | E-MTAB-5699 | biostudies-arrayexpress

Transcription profiling of trf3 morpholino treated zebrafish embryos to identify Trf3 target genes

Project description:To identify Trf3 target genes, we performed expression profiling in trf3 MO-treated embryos (at 6 hpf) using a zebrafish oligonucleotide microarray representing ~12,800 genes.

2007-10-29 | E-MEXP-1279 | biostudies-arrayexpress

Quantitative profiling of proteome extracted from zebrafish embryos exposed to different concentrations of the fungicide difenoconazole against untreated control groups.

Project description:In the present study OMICs analysis was employed to investigate the early molecular responses of zebrafish embryos to exposure to the fungicide difenoconazole. Difenoconazole, a sterol biosynthesis inhibitor according to Fungicide Resistance Action Committee (FRAC) classification, may also induce adverse effects on non-target organisms inhabiting the environment. Early molecular responses in terms of transcriptome and proteome analysis were investigated and refined to select potentially substance specific biomarker candidates for early prediction of difenoconazole toxicity in zebrafish embryos.

2024-01-02 | PXD045650 | Pride

Quantitative profiling of proteome extracted from zebrafish embryos exposed to different concentrations of the fungicide metalaxyl against untreated control groups.

Project description:In the present study OMICs analysis was employed to investigate the early molecular responses of zebrafish embryos to exposure to the fungicide metalaxyl. Metalaxyl, a nucleic acid metabolism inhibitor according to Fungicide Resistance Action Committee (FRAC) classification, may also induce adverse effects on non-target organisms inhabiting the environment. Early molecular responses in terms of transcriptome and proteome analysis were investigated and refined to select potentially substance specific biomarker candidates for early prediction of metalaxyl toxicity in zebrafish embryos.

2024-01-02 | PXD045444 | Pride

Proteomics of SEMA5A, MT-ATP6, ZNF662, and KDM4C in zebrafish embryos

Project description:Proteomics of SEMA5A, MT-ATP6, ZNF662, and KDM4C in zebrafish embryos

2024-02-05 | PXD049175 |

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

MeHg exposure zebrafish embryos vs control

Project description:Gene respons in the central nervous system of zebrafish embryos exposed to the neurotoxicant methyl mercury

2012-05-15 | GSE37970 | GEO

Zebrafish embryo Kac - Global proteomic analysis of lysine acetylation in zebrafish (Danio rerio) embryos

Project description:Zebrafish (Danio rerio) model system have used widespread vertebrate investigations for genetic and cell biological analyses, and is suitable for small molecular screens such as chemical, toxicity and drug in order to use for human diseases and drug discovery . Recently, These powerful zebrafish model increasingly apply to human metabolic disease such as obesity and diabetes and toxicology. Despite a lot of advantages, proteomics research at zebrafish has received little interest in comparison with genetic and biological research using histology and in situ hybridization. Protein lysine acetylation is one of the most known post-translational modifications with dynamic and reversibly controlled by lysine acetyltransferase such as histone acetyltransferases and lysine deacetylase such as histone deacetylases and sirtuins family.Also, during the past year, global lysine acetylome studies using MS-based proteomics approach was in diverse species such as human, mouse, E. coli, Yeast and plants. Based on global acetylome data, our understanding of the roles of lysine acetylation in various cellular processes has increased. . The aim of this study was to identify Lysine acetylation in zebrafish embryos and determine the homology from Human at modified site level. Here we showed the global lysine acetylation study in Zebrafish embryos using MS-based zebrafish embryos.

2016-10-10 | PXD003455 | Pride

MeHg exposure zebrafish embryos vs control

Project description:Gene respons in the central nervous system of zebrafish embryos exposed to the neurotoxicant methyl mercury Two-condition experiment, control vs MeHg exposure embryos (60 Âµg/l), Biological replicates: 4, dye swaps

2012-05-14 | E-GEOD-37970 | biostudies-arrayexpress

Zebrafish embryos: Control vs. 5-aza-2'-deoxycytidine treated

Project description:Transcriptional profiling of 24 hours post-fertilization zebrafish embryos comparing control untreated embryos with embryos raised in 75uM 5-azadC. 5-azadC blocks methylation. The goal was to determine genes regulated by methylation during development.

2009-10-14 | GSE18522 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data