Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
Project description:Wolbachia, an endosymbiotic bacterium, is being investigated as a vector control agent in several insect species. Along with the well known classical reproductive parasitism Wolbachia employs against its host to spread within the population, it is emerging that the bacteria can protect the host against pathogens and reduced pathogen transmission. Anopheles mosquitoes, which transmit malaria, have never been found to harbour Wolbachia in nature, and despite numerous transinfection attempts, no stable line has been developed. However recently, two strains of Wolbachia, wAlbB from Aedes albopictus, and wRi from Drosophila simulans were cultured in Anopheles gambiae Sua5B cells. These cell lines provides an amenable system to study Wolbachia-Anopheles interaction in the absence of a stable transinfected line. It has been proposed that the compromised vector competence of Wolbachia infected insects is due to an up regulation of the basal immune state. We therefore completed a genome wide expression profile of Wolbachia infected Anopheles, assessing both wAlbB and wRi infected cells in parallel against uninfected Sua5B cells.
Project description:Anopheles mosquitoes are known as dominant vectors of malaria parasites and other viral and bacterial pathogens. Fine-tune interactions between host and pathogens modulate the global distribution of mosquito-borne diseases. The way of those interactions may vary between different Anopheles species providing biological advantages for ones and limitations for others. Transmitting ability of mosquitoes can also differ between species, raising the challenging but principal questions. Deciphering the genomes has opened a new era of research and allowed to uncover in depth several molecular mechanisms involved in pathogen transmission. Nowadays there is a lack of appropriate model systems to study specific vector-pathogen interactions at molecular level. Even inbred mosquito colonies represent a heterogeneous population of cells and require special care facilities. Insect cell cultures could serve as a useful alternative due to the ease of handling and maintaining, especially for genomic studies requiring millions of cells per experiment. Here, we provide chromatin contacts heatmap and a comprehensive dataset of epigenetic characteristics, including histone marks profiles as well as RNA-seq data, for MSQ43 - established earlier cell line, initially obtained from Anopheles stephensi larva, known as a keynote malaria vector in Southeast Asia. We assume that our genomic data will be of interest for scientists who can potentially/alternatively use MSQ43 as a model system for mosquito genomic studies.
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
Project description:Anopheline mosquitoes frequently take multiple blood meals in a single gonotrophic cycle. In this study we determined patterns of gene expression in Anopheles gambiae females blood fed twice within the first gonotrophic cycle.
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
Project description:Small RNAs of the Piwi-interacting RNA class (piRNA) play a key role in controlling the activity of transposable elements (TEs) in the animal germ line. In some arthropod species, including mosquitoes, the vectors of malaria and other pathogens, the piRNA pathway is active not only in the gonads, where it controls TE activity, but also in somatic tissues, where its targets and functions are less clear. It is thought that the piRNA pathway in somatic tissues is involved in the antiviral response and the modulation of TE activity. Here, we studied the features of small RNA production in head and thorax somatic tissues of Anopheles coluzzii focusing on the small RNAs processed from protein-coding gene mRNAs. We revealed tissue and sex specificity in the production of small RNAs derived from the genic transcripts. Genic small RNAs of 24-30 nt in length are atypical RNAs that lack the hallmarks of piRNAs. The majority of these short RNAs are derived from mitochondrial and nuclear genes involved in energy metabolism. We discuss the peculiarities of the piRNA biogenesis in Anopheles species which may result in the production of genic small RNAs in the somatic tissues.
Project description:Mosquitoes are the vectors of a variety of infectious diseases. Olfaction and circadian rhythm gate different behavioral events in mosquitoes. However, the mechanisms of odor detection and processing of chemical signals, which are essential for olfactory perception, is poorly understood, including how perception changes in response to zeitgeber time in different mosquito species. To this end, we performed a circadian-dependent RNA-Sequencing study of the brain and peripheral olfactory-tissues of female Anopheles and Aedes mosquitoes. Data analysis revealed a significant upregulation of genes encoding: (a) chemosensory proteins (CSPs), required for transportation of odorant molecules towards the olfactory receptors, and; (b) xenobiotic-metabolizing enzymes (XMEs) during the dusk-transition phase. While XMEs primarily function in the elimination of toxic xenobiotics, concurrent elevation of XMEs and CSPs are hypothesized to act cumulatively for the regulation of perireceptor events and odorant sensitivity. During navigation towards their vertebrate-host/floral-host/mate-partners, female mosquitoes are exposed to diverse environmental chemicals of varied release rates that require continuous degradation/biotransformation by XMEs to avoid receptor saturation in such a noisy environment. Finally, our electroantennographic (EAG) analysis with both Anopheles and Aedes mosquitoes against diverse active volatile odorants, combined with XMEs inhibitors and RNAi studies, establish the proof-of-concept that XMEs function in peri-receptor events during odorant perception and influence the odorant sensitivity in mosquitoes. Additionally, our RNA-Seq and RNAi data also revealed that daily temporal modulation of neuronal serine proteases may facilitate the reorganization of synaptic connections influencing synaptic plasticity and olfactory perception in mosquitoes. In summary, this study highlights the crucial function of XMEs in odorant reception, therefore, improved understanding of species-specific rhythmic expression may provide an important information for successful implementation of mosquito control methods.
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test