Ontology highlight
ABSTRACT:
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| Other | ||||
| ERR637419.fastq.gz | Fastqsanger.gz | |||
| ERR637419_1.fastq.gz | Fastqsanger.gz | |||
| ERR637419_2.fastq.gz | Fastqsanger.gz | |||
| ERR764952_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:We applied direct RNA long read sequencing for characterization of transcripts from constructs inserted into HEK293T mammalian cells with different promoters. Direct RNA sequencing was performed on an Oxford Nanopore GridION device using the Direct Sequencing Kit (SQK-RNA004, date accessed 15 May 2024), MinION RNA flow cell (FLO-MIN00RA), and data pre-processing was performed with MinKNOW (v24.06.10).
2025-06-19 | GSE283443 | GEO
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:3'-end sequencing and Oxford Nanopore Technologies long-read sequencing of trophozoite RNA to define mRNA cleavage sites
2022-03-09 | GSE168675 | GEO
Project description:Whole-genome bisulfite sequencing (WGBS) is currently the gold standard for DNA methylation (5-methylcytosine, 5mC) profiling, however the destructive nature of sodium bisulfite results in DNA fragmentation and subsequent biases in sequencing data. Such issues have led to the development of bisulfite-free methods for 5mC detection. Nanopore sequencing is a long read non-destructive approach that directly analyzes DNA and RNA fragments in real time. Recently, computational tools have been developed that enable base-resolution detection of 5mC from Oxford Nanopore sequencing data. In this chapter we provide a detailed protocol for preparation, sequencing, read assembly and analysis of genome-wide 5mC using Nanopore sequencing technologies.
2021-12-03 | GSE179673 | GEO
Project description:Golparian et al. WGS of Neisseria gonorrhoeae using MinION sequencer (Oxford Nanopore Technologies).
| PRJEB25703 | ENA
Project description:Purpose: To generate a reference long-read transcriptomic data set for use in developing new analysis pipelines and comparing their performance with existing methods. Synthetic “sequin” RNA standards (Hardwick et al. 2016) were sequenced using the Oxford Nanopore Technologies (ONT) GridION platform.
2020-06-18 | GSE151984 | GEO
Project description:We performed direct cDNA sequencing in HeLa GFP∆Promoter cells by Oxford Nanopore Technology (ONT) on a MinION device to detect EGFP RNA levels after DSB induction.
2026-05-15 | E-MTAB-16605 | biostudies-arrayexpress
Project description:Alternative splicing significantly contributes to transcriptome complexity and has critical implications for cellular functions. Recent advancements in single-cell isolation and capture techniques have enabled high-throughput quantification of gene expression at single-cell resolution. Long-read sequencing technologies can further be combined with single-cell technologies and enable an unambiguous identification of complete exon structures. Several computational methods have been developed to specifically address bioinformatics challenges associated with the processing of long read scRNA-seq data. Evaluating and comparing these computational methods becomes crucial. The goal of this study was to benchmark state-of-the-art computational tools for single-cell and spatial long-read transcriptomics. The scRNA-seq data were generated from two tumors developed by a mouse model, and designated as MPNST1 and MPNST2. Data were obtained by using the 10X Genomics technology, then generating sequencing libraries using either Illumina, Oxford Nanopore Technology (ONT) or scNaUmi-Seq protocols. Raw data were obtained after sequencing the libraries on Illumina, MinION or PromethION sequencing platforms. The two Illumina data were uploaded as part of the related submission E-MTAB-14222, with sample MPNST1 corresponding to 2020_23 and MPNST2 to 2022_26. This current submission contains the four long-read raw data et the data processed using the wf-single-cell pipeline. For the additional processed data, please refer to https://github.com/GenomiqueENS/scKenver.
2025-08-26 | E-MTAB-15190 | biostudies-arrayexpress