Ontology highlight
ABSTRACT:
PROVIDER: PRJNA317271 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR3359610_1.fastq.gz | Fastqsanger.gz | |||
| SRR3359610_2.fastq.gz | Fastqsanger.gz | |||
| SRR3359611_1.fastq.gz | Fastqsanger.gz | |||
| SRR3359611_2.fastq.gz | Fastqsanger.gz | |||
| SRR3359614_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 16 |
Similar Datasets
Project description:Golparian et al. WGS of Neisseria gonorrhoeae using MinION sequencer (Oxford Nanopore Technologies).
| PRJEB25703 | ENA
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:We performed direct cDNA sequencing in HeLa GFP∆Promoter cells by Oxford Nanopore Technology (ONT) on a MinION device to detect EGFP RNA levels after DSB induction.
2026-05-15 | E-MTAB-16605 | biostudies-arrayexpress
Project description:We present scNanoATAC-seq (Single-cell Assay for Transposase Accessible Chromatin by Oxford Nanopore Technologies Sequencing), an effective method for simultaneous detection of chromatin accessibility and genetic variation. Long fragments (about 4-5Kb) of single-cell ATAC-seq library were enriched and sequenced by Oxford Nanopore Technologies platform. Ends of long ATAC-seq fragments are regarded as chromatin accessibility signal in downstream analysis.
2022-09-07 | GSE194023 | GEO
Project description:We present scNanoATAC-seq (Single-cell Assay for Transposase Accessible Chromatin by Oxford Nanopore Technologies Sequencing), an effective method for simultaneous detection of chromatin accessibility and genetic variation. Long fragments (about 4-5Kb) of single-cell ATAC-seq library were enriched and sequenced by Oxford Nanopore Technologies platform. Ends of long ATAC-seq fragments are regarded as chromatin accessibility signal in downstream analysis.
2022-09-07 | GSE194022 | GEO
Project description:Purpose: The aim of this study is to identify genes that are under the transcriptional control of the epigenetic modifier Smchd1 in mouse neural stem cells. We profiled the transcriptomes of mouse neural stem cells from samples that were either wild-type or contained a null mutation in the epigenetic regulator Smchd1 using Oxford Nanopore Technologies (ONT) direct cDNA sequencing protocol and a PromethION sequencer.
2020-06-18 | GSE151841 | GEO
Project description:Two sets of 10 samples from patients with CMML were used for this study. The first set (CMML11 to CMML20) includes 10 blood samples supplied by Eric Jourdan (Biological Resource Center CHU-Nimes, France). Peripheral blood mononuclear cells were separated by Ficoll-Hypaque density gradient and preserved in RNA Later. The second set (CMML1 to CMML10), delivered by Eric Solary (Gustave Roussy Institut) consisted of 10 samples from Bone marrow or peripheral blood separated on Fycoll-Hypaque. CD14+ monocytes were then sorted from PBMCs with magnetic beads and the AutoMacs system as previously described by Merlevede et al. (2016). RNA-seq experiments were performed on the twenty samples described above and libraries have been prepared using the “TruSeq Stranded Total RNA Gold” Kit from Illumina. Whole genome sequencing was performed on 1 CMML (sample 10) using the Illumina TruSeq DNA PCR-Free Library Preparation Kit. RNA-Seq full length sequencing were performed on 2 CMMLs (samples 7 and 13) : converted to cDNA using SMART-Seq v4 Ultra Low Input RNA kit (Clontech) and sequenced with the SQK-PBK004 kit (PCR Barcoding kit) on MinION sequencer from Oxford Nanopore Technologies.
2025-07-22 | E-MTAB-13763 | biostudies-arrayexpress
Project description:We applied direct RNA long read sequencing for characterization of transcripts from constructs inserted into HEK293T mammalian cells with different promoters. Direct RNA sequencing was performed on an Oxford Nanopore GridION device using the Direct Sequencing Kit (SQK-RNA004, date accessed 15 May 2024), MinION RNA flow cell (FLO-MIN00RA), and data pre-processing was performed with MinKNOW (v24.06.10).
2025-06-19 | GSE283443 | GEO