Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

In vitro fecal fermentation of dried chicory root

ABSTRACT: In vitro assessment of dried chicory root fermentation by the fecal human microbiota

PROVIDER: PRJEB74436 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR13031029_1.fastq.gz	Fastqsanger.gz
	ERR13031029_2.fastq.gz	Fastqsanger.gz
	ERR13031030_1.fastq.gz	Fastqsanger.gz
	ERR13031030_2.fastq.gz	Fastqsanger.gz
	ERR13031031_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 120

Similar Datasets

In vitro fecal fermentation of dried chicory root

Project description:Changes in the fecal microbial community following in vitro fermentation of dried chicory root particles to produce fermentation supernatants for an ex vivo gut barrier integrity model

| PRJEB74437 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Chicory: cutting the effects and the effectors for a functional food

Project description:Whole chicory flour (Chic) and three compounds of chicory roots: fructose (Fru), chlorogenic acids (CGA) and sesquiterpene lactones (STL) were separately analyzed for their health effects in mice. A whole transcriptomic analysis was conducted using Agilent DNA microarrays to investigate their nutrigenomic effects.

2022-03-24 | GSE190056 | GEO

Dried seaweed

Project description:Dried seaweed Raw sequence reads

| PRJNA1088076 | ENA

Dietary Inclusion of Dried Chicory Root Affects Cecal Mucosa Proteome of Nursery Pigs.

Project description:Prebiotics are known to have many beneficial effects on intestinal health by modulating the gut microbiota composition, thereby affecting epithelial cell proliferation and metabolism. This study had two aims: (1) to identify the protein constituents in the cecal mucosa of 50-day-old healthy (PIC × Penarlan P76) barrows, and (2) to assess the effects of 4% inclusion of dried chicory root in a cereal-based diet on the cecal mucosa proteome changes. Pigs (eight per group) were randomly allotted to the groups and were fed a control diet from the tenth day of life (C) or a diet supplemented with 4% of died chicory root (CR), for 40 days. At the age of 50 days, animals were sacrificed and cecal tissue samples were collected. It was found that feeding a CR diet significantly decreased the expression of 16 cecal mucosa proteins. Among them, fifteen proteins were down-regulated, while only one (KRT20) was shown to be up-regulated when compared to the C group. Dietary supplementation with CR caused down-expression of metabolism-associated proteins including enzymes involved in the process of glycolysis (G6PD, TPI1, ALDH9A1, CKMT1 and AKR1A1) as well as those engaged in transcriptional and translational activity (PRPF19, EEF1G) and several structural proteins (ACTR3, KRT77, CAP1 and actin). From our findings, it is possible to conclude that dietary chicory root at 4% had beneficial effects on the gut health of pigs as indicated by a changed abundance of certain cecal proteins such as KRT20, SERPINB1, HSP27, ANAXA2 and ANAXA4.

| S-EPMC9264899 | biostudies-literature

Chicory – a functional food with multiple effects: cancer-prevention, antimicrobial resistance, glycemia and lipidemia regulation

Project description:We experimented on murine model and attempted to point several mechanisms by which the chicory roots acts as a functional food. To this goal, a nutrigenomic analysis was performed.

2020-10-20 | GSE150218 | GEO

Microbial community composition from dried fecal material of five animal species

Project description:Shotgun metagenomes of dried animal feces.

| PRJEB80559 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Analysis of the fermentation kinetics and gut microbiota modulatory effect of dried chicory root reveals the impact of the plant-cell matrix rationalizing its conversion in the distal colon.

Project description:Aim: The cell matrix of plant foods has received little attention in prebiotic fiber research. We aimed to understand the impact of the plant cell matrix in dried chicory root on its breakdown in the human gut to explain its reported beneficial effects on gut and metabolic health. Methods: We applied in vitro digestion and fermentation models together with an ex vivo gut barrier integrity model. Plant cell matrix intactness in the upper gastrointestinal tract was investigated by scanning electron microscopy. Colonic breakdown of inulin, and chicory root cubes and powder was assessed by gut microbiota analysis using 16S rRNA gene amplicon sequencing and determining the kinetics of changes in pH, gas, and short-chain fatty acid (SCFA) production. Finally, effects on gut barrier integrity were explored by exposing colonic biopsies to fermentation supernatants in an Ussing chamber model. Results: The plant cell matrix of dried chicory root cubes remained intact throughout upper gastrointestinal transit. Dried chicory root fermentation resulted in higher final relative abundances of pectin-degrading Monoglobus and butyrate-producing Roseburia spp. compared to inulin and a seven-fold increase in Bifidobacterium spp. in donors where these species were present. Dried chicory root cubes yielded similar total SCFAs but higher final butyrate levels than chicory root powder or isolated inulin with less gas produced. No uniform but donor-specific effects of fermentation supernatants on the maintenance of gut barrier integrity were detected. Conclusion: The intact plant cell matrix of dried chicory root affected its colonic breakdown kinetics and microbiota, underpinning its beneficial effect in vivo.

| S-EPMC11485554 | biostudies-literature

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:Hhigh-throughput sequencing of in vitro fecal fermentation samples

| PRJNA860582 | ENA