Oryza sativa
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA110963 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Genome-wide effect of cholera toxin and nitrate treatment in etiolated rice plants
| PRJNA124359 | ENA
Project description:LongSAGE library in this series are from 'Whole Genome Analysis of Pathogen-Host Recognition and Subsequent Responses in the Rice Blast Patho-System' project. This work is supported by NSF-PGRP #0115642. Keywords: other
2004-11-08 | GSE1924 | GEO
Project description:Although Cochliobolus miyabeanus is an important fungal leaf pathogen on rice plants worldwide, it is largely neglected by molecular plant phytopathologists. To shed new light on the molecular and genetic basis of the rice – C. miyabeanus interaction, we compared the transcriptome of rice leaves 12h post inoculation to uninfected leaves. Even though usable sources of resistance against brown spot disease caused by C. miyabeanus are scarce, silicon application emerges as a sustainable protection strategy. Many articles report the beneficial effect of silicon on brown spot resistance. however the underlying mechanisms remain largely unclear. The influence of silicon application on the transcriptome of healthy and infected rice leaves 12hpi was compared as well in an attempt to disentangle the modulation of silicon-induced brown spot resistance.
2014-02-25 | GSE55330 | GEO
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:The current study aimed at segregating the light and nitrate effect in rice plants (Oryza sativa indica). The primary aim of the study was to demarcate the genes that were purely regulated by light and nitrate. A separate list of genes that were co-regulated by these two signals would provide insights into the exact mode of regulation of primary metabolic pathways.
2009-12-31 | GSE12940 | GEO
Project description:To reveal the underlying molecular mechanism of jasmonate inhibits gibberellins signaling in rice, we performed transcriptional profiling of wild type nipponbare and mutant coi1-13 plants on a global scale using the Affymetrix GeneChip Rice Genome Array
2011-12-01 | GSE29577 | GEO
Project description:Chilling stress is a major abiotic stress that affects rice growth and development. Rice seedlings are quite sensitive to chilling stress and this harms global rice production. Comprehensive studies of the molecular mechanisms for response to low temperature are of fundamental importance to chilling tolerance improvement. The number of identified cold regulated genes (CORs) in rice is still very small. Circadian clock is an endogenous timer that enables plants to cope with forever changing surroundings including light–dark cycles imposed by the rotation of the planet. Previous studies have demonstrated that the circadian clock regulates stress tolerances in plants show circadian clock regulation of plant stress tolerances. However, little is known about coordination of the circadian clock in rice chilling tolerance. In this study, we investigated rice responses to chilling stress under conditions with natural light-dark cycles. We demonstrated that chilling stress occurring at nighttime significantly decreased chlorophyll content and photosynthesis efficiency in comparison with that occurring at daytime. Transcriptome analysis characterized novel CORs in indica rice, and suggested that circadian clock obviously interferes with cold effects on key genes in chlorophyll (Chl) biosynthesis pathway and photosynthesis-antenna proteins. Expression profiling revealed that chilling stress during different Zeitberger times (ZTs) at nighttime repressed the expression of those genes involved Chl biosynthesis and photosynthesis, whereas stress during ZTs at daytime increases their expression dramatically. Moreover, marker genes OsDREBs for chilling tolerance were regulated differentially by the chilling stress occurring at different ZTs. The phase and amplitude of oscillation curves of core clock component genes such as OsLHY and OsPRR1 are regulated by chilling stress, suggesting the role of chilling stress as an input signal to the rice circadian clock. Our work revealed impacts of circadian clock on chilling responses in rice, and proved that the effects on the fitness costs are varying with the time in a day when the chilling stress occurs.
2022-03-01 | GSE146174 | GEO
Project description:The goal of this work is to identify the gene regulatory hubs that control nitrogen-use in Oryza sativa, one of the most important crop plants, by using a combination of genomics, bioinformatics and systems biology approaches. Here, we evaluate the role of bZIP1, a transcription factor involved in light and nitrogen sensing, by exposing wild-type (WT) and bZIP1 T-DNA null mutant plants to a combinatorial space of N and L treatment conditions. We use ANOVA analysis combined with clustering and Boolean modeling, to evaluate the role of bZIP1 in mediating L and N signaling genome-wide. We also study the interspecies conservation, comparing rice with Arabidopsis thaliana nitrogen transcriptomes, to help identify conserved nitrogen regulation.
2015-06-10 | E-GEOD-38102 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:Transcriptional profiling of MIT knockdown plants. MIT is a mitochondrial Fe transporter essential for rice growth and development. The goal was to determine the effects of MIT on global rice gene expression.
2011-04-07 | GSE28428 | GEO