Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

ABSTRACT: The transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

PROVIDER: PRJNA1136975 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR29868335_1.fastq.gz	Fastqsanger.gz
	SRR29868335_2.fastq.gz	Fastqsanger.gz
	SRR29868336_1.fastq.gz	Fastqsanger.gz
	SRR29868336_2.fastq.gz	Fastqsanger.gz
	SRR29868337_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

The transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

Project description:We report the RNA-seq based analyses of the transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

2025-03-26 | GSE272494 | GEO

Anopheles dirus

Project description:Anopheles dirus overview

| PRJNA67285 | ENA

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Anopheles dirus

Project description:Blood induced differential gene expression in Anopheles dirus

| PRJNA416343 | ENA

Anopheles dirus strain:WRAIR2

Project description:Anopheles dirus WRAIR2 Genome sequencing project

| PRJNA67231 | ENA

Anopheles dirus strain:WRAIR2

Project description:Transcriptome of Anopheles dirus infected with P.berghei

| PRJNA397952 | ENA

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Anopheles dirus

Project description:Transcriptome analysis of Anopheles dirus and Plasmodium vivax at ookinete and oocyst stages

| PRJNA564461 | ENA

Anopheles dirus

Project description:Transcriptome analysis of Anopheles dirus and Plasmodium vivax at oocyst stages at day 7

| PRJNA564598 | ENA

Lysinibacillus sphaericus strain:BS-pBtoxis | isolate:BS-pBtoxis

Project description:Lysinibacillus sphaericus strain:BS-pBtoxis | isolate:BS-pBtoxis Genome sequencing

| PRJNA708144 | ENA