Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1142222 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Metagenome data from soil samples were collected at 0 to 10cm deep from 2 avocado orchards in Channybearup, Western Australia, in 2024. Amplicon sequence variant (ASV) tables were constructed based on the DADA2 pipeline with default parameters.
2025-06-15 | GSE298403 | GEO
Project description:Deadwood fungal community survey by amplicon sequencing
| PRJNA887894 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:<p>Next generation sequencing has aided characterization of genomic variation. While whole genome sequencing may capture all possible mutations, whole exome sequencing is more cost-effective and captures most phenotype-altering mutations. Initial strategies for exome enrichment utilized a hybridization-based capture approach. Recently, amplicon-based methods were designed to simplify preparation and utilize smaller DNA inputs. We appraised two hybridization capture-based and two amplicon-based whole exome sequencing methods, utilizing both Illumina and Ion Torrent sequencers, comparing on-target alignment, uniformity, and variant calling. While the amplicon methods had higher on-target rates, the hybridization capture-based approaches showed better uniformity. All methods identified many of the same single nucleotide variants, but each amplicon-based method missed variants detected by the other three methods and reported additional variants discordant with all three other technologies. Many of these potential false positives or negatives appear to result from limited coverage, low variant frequency, vicinity to read starts/ends, or the need for platform-specific variant calling algorithms. All methods demonstrated effective copy number variant calling when compared against a single nucleotide polymorphism array. This study illustrates some differences between various whole exome sequencing approaches, highlights the need for selecting appropriate variant calling based on capture method, and will aid laboratories in selecting their preferred approach.</p>
| phs000938 | dbGaP
Project description:Amplicon-based targeted re-sequencing analysis was performed in the patient-derived gliobastoma cell culture samples. For this purpose, genomic DNA (gDNA) was isolated and DNA libraries were prepared using the TruSeq Custom Amplicon Low Input (Illumina, Inc.) technology. By this, a pool of 375 amplicons was generated for each single sample in order to enrich for the target genes ATRX1, EGFR, IDH1, NF1, PDGFRA, PIK3CG, PIK3R1, PTEN, RB1 and TP53. Sequencing was performed on the Illumina MiSeq® next generation sequencing system (Illumina Inc.) and its 2 x 250 bp paired-end v2 read chemistry. The resulting reads were quality controlled and mapped against the human reference genome (hg19). For all samples, sequence variations of the amplified regions of interest in comparison to the human reference sequence were identified and filtered based on reliability.
2021-07-07 | E-MTAB-9343 | biostudies-arrayexpress
Project description:Contaminated aquifer (Dusseldorf-Flinger, Germany) templates extracted from 5 sediment depths ranging between 6.4 and 8.4 m below ground and over 3 years of sampling were amplified for amplicon pyrosequencing using the primers Ba27f (5’-aga gtt tga tcm tgg ctc ag-3’) and Ba519r (5’- tat tac cgc ggc kgc tg-3’), extended as amplicon fusion primers with respective primer A or B adapters, key sequence and multiplex identifiers (MID) as recommended by 454/Roche. Amplicons were purified and pooled as specified by the manufacturer. Emulsion PCR (emPCR), purification of DNA-enriched beads and sequencing run were performed following protocols and using a 2nd generation pyrosequencer (454 GS FLX Titanium, Roche) as recommended by the developer. Quality filtering of the pyrosequencing reads was performed using the automatic amplicon pipeline of the GS Run Processor (Roche), with a slight modification concerning the valley filter (vfScanAllFlows false instead of TiOnly) to extract the sequences. Demultiplexed raw reads were furhter trimmed for quality and lenght (>250 bp).
2012-11-11 | GSE25345 | GEO
Project description:Forest deadwood Microbe Raw sequence reads
| PRJNA1254429 | ENA
Project description:Deadwood stochasticity
| PRJEB65750 | ENA