Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1143177 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:In this paper, we first report that EC smoking significantly increases the odds of gingival inflammation. Then, we seek to identify and explain the mechanism that underlies the relationship between EC smoking and gingival inflammation via the oral microbiome. We performed mediation analyses to assess if EC smoking affects the oral microbiome, which in turn affects gingival inflammation. For this, we collected saliva and subgingival samples from EC users and non-users and profiled their microbial compositions via 16S rRNA amplicon sequencing. We then performed α-diversity, β-diversity, and taxonomic differential analyses to survey the disparity in microbial composition between EC users and non-users. We found significant increases in α-diversity in EC users and disparities in β-diversity between EC users and non-users.
2022-12-09 | GSE201949 | GEO
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
2023-05-31 | GSE206765 | GEO
Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
2026-01-28 | GSE291841 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
| 2255499 | ecrin-mdr-crc
Project description:Swine confinement buildings (SCBs) represent workplaces with high biological air pollution. It is suspected that individual components of inhalable air are causatives of chronic respiratory disease that are regularly detected among workers. In order to understand the relationship between exposure and stress, the aim of this study was to develop a method to investigate the components of bioaerosols in more detail. For this purpose, bioaerosols from pig barns were collected on quartz filters from two exclusively housed pig types (porkers and gestating sows) and subsequently analyzed via a combinatorial approach of 16S rRNA amplicon sequencing and metaproteomics. The workflow helps to clarify diversity in bioaerosols from a taxonomic perspective, but also from a functional perspective.
2024-01-26 | PXD039685 | Pride
Project description:Background: Saliva is an attractive body fluid for non-invasive biomarker discovery, containing both human and microbial components, associated with various chronic diseases. Type-2 diabetes (T2D) imposes a significant health and socio-economic burden. Prior research on T2D salivary microbiome utilised methods such as metagenomics, metatranscriptomics, 16S rRNA sequencing, and low-throughput proteomics. Results: We conducted ultra-fast, in-depth MS-based profiling of saliva from 15 T2D individuals and 15 age/BMI-matched healthy controls (HC). Using state-of-the-art proteomics, over 4500 proteins were identified in 21 minutes of analysis, including both human and bacterial proteins. Analysis revealed signatures of altered immune, lipid- and glucose-metabolism regulatory systems, increased oxidative stress, and possible precancerous changes in T2D saliva. Bacterial genera Neisseria and Corynebacterium showed biomarker potential, offering insights into disease pathophysiology and microbial applications for T2D management. Conclusions: This study provides a comprehensive map of salivary proteins and microbial communities, serving as a resource for better understanding of T2D pathophysiology. The identified biomarkers offer potential for improved diagnostics and therapeutic strategies in T2D and associated long-term complications.
2025-05-06 | PXD051453 | Pride