Lettuce
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1164634 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR31595200.fastq.gz | Fastqsanger.gz | |||
| SRR31595201.fastq.gz | Fastqsanger.gz | |||
| SRR31595202.fastq.gz | Fastqsanger.gz | |||
| SRR31595203.fastq.gz | Fastqsanger.gz | |||
| SRR31595204.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 131 |
Similar Datasets
Project description:Lettuce 16S rRNA gene amplicon sequence reads Raw sequence reads
| PRJNA486409 | ENA
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:Phage-plasmids produce antibiotic resistant lysogens
| PRJEB52357 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
2024-12-30 | GSE229693 | GEO
Project description:The association between soil microbes and plant roots is present in all natural and agricultural environments. Microbes can be beneficial, pathogenic, or neutral to the host plant development and adaptation to abiotic or biotic stresses. Progress in investigating the functions and changes in microbial communities in diverse environments have been rapidly developing in recent years, but the changes in root function is still largely understudied. The aim of this study was to determine how soil bacteria influence maize root transcription and microRNAs (miRNAs) populations in a controlled inoculation of known microbes over a defined time course. At each time point after inoculation of the maize inbred line B73 with ten bacterial isolates, DNA and RNA were isolated from roots. The V4 region of the 16S rRNA gene was amplified from the DNA and sequenced with the Illumina MiSeq platform. Amplicon sequencing of the 16S rRNA gene indicated that most of the microbes successfully colonized maize roots. The colonization was dynamic over time and varied with the specific bacterial isolate. Small RNA sequencing and mRNA-Seq was done to capture changes in the root transcriptome from 0.5 to 480 hours after inoculation. The transcriptome and small RNA analyses revealed epigenetic and transcriptional changes in roots due to the microbial inoculation. This research provides the foundational data needed to understand how plant roots interact with bacterial partners and will be used to develop predictive models for root response to bacteria.
2023-05-01 | GSE214656 | GEO