Project description:In this study, we performed a comparative analysis of gut microbiota composition and gut microbiome-derived bacterial extracellular vesicles (bEVs) isolated from patients with solid tumours and healthy controls. After isolating bEVs from the faeces of solid tumour patients and healthy controls, we performed spectrometry analysis of their proteomes and next-generation sequencing (NGS) of the 16S gene. We also investigated the gut microbiomes of faeces from patientsand controls using 16S rRNA sequencing. Machine learning was used to classify the samples into patients and controls based on their bEVs and faecal microbiomes.
Project description:Durum wheat (Triticum turgidum L. ssp. durum) is a major cereal and staple in the semi-arid regions of the Mediterranean Basin. After assembling the Platinum-quality reference genome for Svevo durum wheat cultivar, coupling PACBIO HiFi long read 35X sequencing with BIONANO Optical Mapping and Hi-C conformation capture, a complete and accurate gene annotation was then obtained by coupling Illumina RNASeq and Nanopore Isoseq sequencing from multiple tissues. Gene expression was investigated in spikelets inoculated with Fusarium graminearum and in not infected controls to profile the transcriptional regulation of Fusarium head blight infection.
Project description:Durum wheat (Triticum turgidum L. ssp. durum) is a major cereal and staple in the semi-arid regions of the Mediterranean Basin. After assembling the Platinum-quality reference genome for Svevo durum wheat cultivar, coupling PACBIO HiFi long read 35X sequencing with BIONANO Optical Mapping and Hi-C conformation capture, a complete and accurate gene annotation was then obtained by coupling Illumina RNASeq and Nanopore Isoseq sequencing from multiple tissues. The gene expression was investigated in root and shoot samples collected from plants grown under control condition or subjected to heat, salinity and osmotic stresses or to nitrogen application to create a transcriptional atlas of durum wheat response to abiotic stresses.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
