Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: The OTUs of the endophytic bacteria sequenced by high-throughput sequencing

PROVIDER: PRJNA1178093 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR31166023_subreads.fastq.gz	Fastqsanger.gz
	SRR31166024_subreads.fastq.gz	Fastqsanger.gz
	SRR31166025_subreads.fastq.gz	Fastqsanger.gz
	SRR31166026_subreads.fastq.gz	Fastqsanger.gz
	SRR31166027_subreads.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 30

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Project description:Genetic Analysis of Endophytic Bacteria through High-Throughput Sequencing

| PRJNA434414 | ENA

To explore the relationship between new gene expression / mutation and survival of patients in colorectal cancer

Project description:Interventions: Case vs control:No Primary outcome(s): High-throughput sequencing Study Design: Case-Control study

| 2676067 | ecrin-mdr-crc

Gut microbiota analysis associated with hepatocellular carcinoma

Project description:Here we report 16s rRNA data in gut microbiota of hepatocellular carcinoma (HCC) patients with HBV induced HCC (HBVC) and non-HBV induced HCC (NHBVC) compared with healthy volunteers. A total of 2047 operational taxonomic units (OTUs) were identified in the sequence data. Our data shows that the NHBVC patients harbor lower anti-inflammatory bacteria and more pro-inflammatory bacteria, while the HBVC patients harbor more anti-inflammatory bacteria.

2019-02-27 | GSE108847 | GEO

Gut microbiota analysis of kdm5 mutant and the flies with KDM5 knockdown in intestine tissue

Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.

2019-02-08 | GSE98944 | GEO

Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology

Project description:To determine the extent to which the major small RNA pathways functions across the Arabidopsis thaliana genome, small RNA populations from several tissues of wild-type (wt) and mutant plants were amplified by RT-PCR and sequenced using high-throughput 454 sequencing technology. Keywords: small RNAs, high-throughput sequencing

2007-02-01 | GSE6682 | GEO

Project description:High Throughput Sequencing of Soil Bacteria

| PRJNA765466 | ENA

Project description:High-throughput sequencing analysis of bacteria

| PRJNA857319 | ENA

Project description:High throughput sequencing of soil bacteria

| PRJNA681632 | ENA

Project description:High-throughput sequencing of soil bacteria

| PRJNA578945 | ENA