Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Sequencing of tick 16S V3-V4 in the border area of China, Russia and North Korea

PROVIDER: PRJNA1225783 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR32404600_1.fastq.gz	Fastqsanger.gz
	SRR32404600_2.fastq.gz	Fastqsanger.gz
	SRR32404601_1.fastq.gz	Fastqsanger.gz
	SRR32404601_2.fastq.gz	Fastqsanger.gz
	SRR32404602_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 294

Similar Datasets

Project description:Metatranscriptomics of Ixodes persulcatus tick in the China-North Korea border

| PRJNA981661 | ENA

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Gut Dysbiosis Impacts Brain Metastasis Outgrowth and Immune Response Dynamics

Project description:We used 16S V3/V4 region amplification to evaluate the composition of bacteria species in mouse fecal pellets after vehicle or ABX treatment and before and after fecal matter transplant.

2025-02-05 | GSE270809 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

First exploration of the altered microbial gut-lung axis in the pathogenesis of human refractory chronic cough

Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.

2024-04-17 | GSE240646 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Assessing Genetic Diversity of Asian Salamanders (Hynobiidae) lived in Far East Asia using Transcriptome data

Project description:Asian salamander Hynobiidae is commonly observed in the Far East Asia regions, including Korea, Japan, China, and the eastern region of Russia. In Korea, there are four Hynobiidae species known to be lived: Hynobius leechii, Hynobius quelpaertensis, Hynobius yangi, and recently reported Hynobius unisacculus. However, even H. leechii which is broadly colonized in Korea peninsula seems to have a new species candidate, which has distinctive genetic and phenotypic characteristics. Genomic resources are essential to understand the current status of these species, but due to the large size of their genomes (about 16 to 20 Gb), it is not easy to analyze. To reveal the genomic characteristics of these species, we constructed more than ten thousands of protein-coding gene sequences from multiple samples of each species, using the de novo transcriptome assembly approach from RNA-Seq data, confirming their taxonomic relationship which was reported based on mitochondrial DNA and marker genes. Also, by comparing previously reported transcriptome of Hynobius chinensis and Hynobius retardatus, lived in China and Japan, respectively, we found that Korean species have unique genetic signatures. By comparing vertebrate model organism genes, we reported Hynobidaii specific proteins. These data would be a useful resource to study other Caudata species in the future. This research was supported by the National Institute of Biological Resources, Republic of Korea, under the project "Genetic diversity of animal resources” (NIBR201703203 and NIBR201803101).

2019-12-24 | GSE137677 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data