Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Microbial composition of sow feces after in vitro fermentation

PROVIDER: PRJNA1234503 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR32651531_1.fastq.gz	Fastqsanger.gz
	SRR32651531_2.fastq.gz	Fastqsanger.gz
	SRR32651532_1.fastq.gz	Fastqsanger.gz
	SRR32651532_2.fastq.gz	Fastqsanger.gz
	SRR32651533_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 18

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Transcription profiling of piglet ileal tissues to assess the impact of environment on microbial diversity and global transcriptional responses in the developing gut

Project description:The study investigated the impact of environment on the composition of the gut microbiota and mucosal immune development and function at gut surfaces in early and adult life. Piglets of similar genotype were reared in indoor and outdoor environments and in an experimental isolator facility. Mucosa-adherent microbial diversity in the pig ileum was characterized by sequence analysis of 16S rRNA gene libraries. Host-specific gene responses in gut ileal tissues to differences in microbial composition were investigated using Affymetrix microarray technology and Real-time PCR. Experiment Overall Design: Animals were reared on the sow at an outdoor or indoor facility. Additional piglets from the indoor facility were transferred to individual isolator units at 24 hours of age, and given a daily dose of antibiotic cocktail for the duration of the study. Piglets were weaned at day 28. From day 29 onwards, piglets were fed creep feed ad libitum. Ileal tissue samples were excised from N=6 piglets per group at day 5, 28 and 56.

2009-12-05 | E-GEOD-15256 | biostudies-arrayexpress

Project description:Study on microbial diversity of sow feces

| PRJNA692550 | ENA

Effects of starter microbiota on the gastric transcriptome profile of 2 weeks old caesarean derived pigs

Project description:An early settlement of a complex gut microbiota can protect against gastro-intestinal dysbiosis, but the effects of neonatal microbiota colonization on the maturation of the porcine gastric mucosa are largely unknown. The transcriptome of the oxyntic mucosa of 12 caesarian-derived pigs previously associated with microbiota of different complexity was studied. Pigs received sow blood serum at birth (d0), 2 mL of starter microbiota (10^7 CFU of each Lactob. Amylovorus (LAM), Clostr. glycolicum, and Parabacteroides spp.) on d1-d3 of age and either a placebo inoculant (simple association, SA) or an inoculant consisting of diluted feces of an adult sow (complex association, CA) on d3-d4 of age. Then pigs were fed a moist diet . Gastric samples were obtained at on euthanised pigs at 2 weeks of age.

2016-09-21 | GSE87124 | GEO

Project description:Fermentation feed microbial composition

| PRJNA633231 | ENA

Early microbial colonisation affects transcriptome of pig jejunum perfused with E. coli F4, F4 fimbria or Lact. amylovorus

Project description:An early settlement of a complex gut microbiota can protect against gastro-intestinal dysbiosis, but the effects of neonatal microbiota colonization on the gut barrier upon the further encounter of favorable bacteria or not, are largely unknown. The jejunal transcriptome of differently perfused intestinal loops of 12 caesarian-derived pigs previously associated with microbiota of different complexity was studied. Pigs received pasteurized sow colostrum at birth (d0), 2 mL of starter microbiota (10^7 CFU of each Lactob. Amylovorus (LAM), Clostr. glycolicum, and Parabacteroides spp.) on d1-d3 of age and either a placebo inoculant (simple association, SA) or an inoculant consisting of diluted feces of an adult sow (complex association, CA) on d3-d4 of age. On days 26-37 of age, jejunal loops were perfused for 8 h with either enterotoxigenic E. coli F4 (ETEC), F4 fimbriae (F4), LAM or saline (CTRL) and jejunal samples were obtained from each piglet immediately afterwards.

2016-02-11 | GSE77787 | GEO

Project description:Sow feces of different reproductive potential

| PRJNA1253157 | ENA

Feces sample

Project description:Sow feces sample Raw sequence reads

| PRJNA640493 | ENA

Project description:Sequencing for feces of PIC sow

| PRJNA781419 | ENA

Project description:microbial composition of pig feces

| PRJNA1057771 | ENA