Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1241216 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR32834275_1.fastq.gz | Fastqsanger.gz | |||
| SRR32834275_2.fastq.gz | Fastqsanger.gz | |||
| SRR32834276_1.fastq.gz | Fastqsanger.gz | |||
| SRR32834276_2.fastq.gz | Fastqsanger.gz | |||
| SRR32834277_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:Long interspersed nuclear element-1 (LINE1) retrotransposons are classified into different subfamilies based on evolutionary history. For human biology, the L1PA lineage of LINE1s is particularly significant. This lineage contains both retrotransposition-competent and inactive subfamilies. PCR-based methods are widely used to monitor LINE1s in genomic DNA. However, PCR analysis distinguishing between L1PA lineage subfamilies of different evolutionary age is thus far challenging due to the difficulty to design primers that are sufficiently specific. Here, we developed and applied a workflow to design PCR primers that discriminate between different subfamilies of the L1PA lineage. Amplicon sequencing after PCR amplification of genomic DNA confirmed that the primers differentiate between groups of L1PA subfamilies of different evolutionary age. We validated the primers using RT-qPCR and verified consistency with publicly available RNA-seq data. Moreover, inhibition of DNA methyltransferase activity produced a dose-dependent increase in signals from primers selective for the younger subfamilies, consistent with transcriptional de-repression. These primers enable PCR-based surveys that can stratify expression, copy number or epigenetic modification for L1PA subfamilies of differing evolutionary age.
2025-07-09 | GSE301759 | GEO
Project description:Contaminated aquifer (Dusseldorf-Flinger, Germany) templates extracted from 5 sediment depths ranging between 6.4 and 8.4 m below ground and over 3 years of sampling were amplified for amplicon pyrosequencing using the primers Ba27f (5’-aga gtt tga tcm tgg ctc ag-3’) and Ba519r (5’- tat tac cgc ggc kgc tg-3’), extended as amplicon fusion primers with respective primer A or B adapters, key sequence and multiplex identifiers (MID) as recommended by 454/Roche. Amplicons were purified and pooled as specified by the manufacturer. Emulsion PCR (emPCR), purification of DNA-enriched beads and sequencing run were performed following protocols and using a 2nd generation pyrosequencer (454 GS FLX Titanium, Roche) as recommended by the developer. Quality filtering of the pyrosequencing reads was performed using the automatic amplicon pipeline of the GS Run Processor (Roche), with a slight modification concerning the valley filter (vfScanAllFlows false instead of TiOnly) to extract the sequences. Demultiplexed raw reads were furhter trimmed for quality and lenght (>250 bp).
2012-11-11 | GSE25345 | GEO
Project description:Single cell-based studies have revealed tremendous cellular heterogeneity in stem cell and progenitor compartments, suggesting continuous differentiation trajectories with intermixing of cells at various states of lineage commitment and notable degree of plasticity during organogenesis. The hepato-pancreato-biliary organ system relies on a small endoderm progenitor compartment that gives rise to a variety of different adult tissues, including liver, pancreas, gallbladder, and extra-hepatic bile ducts. Experimental manipulation of various developmental signals in the mouse embryo underscored important cellular plasticity in this embryonic territory. This is also reflected in the existence of human genetic syndromes as well as congenital or environmentally-caused human malformations featuring multiorgan phenotypes in liver, pancreas and gallbladder. Nevertheless, the precise lineage hierarchy and succession of events leading to the segregation of an endoderm progenitor compartment into hepatic, biliary, and pancreatic structures are not yet established. Here, we combine computational modelling approaches with genetic lineage tracing to assess the tissue dynamics accompanying the ontogeny of the hepato-pancreato-biliary organ system. We show that a multipotent progenitor domain persists at the border between liver and pancreas, even after pancreatic fate is specified, contributing to the formation of several organ derivatives, including the liver. Moreover, using single-cell RNA sequencing we define a specialized niche that possibly supports such extended cell fate plasticity.
2021-07-01 | MODEL2105030001 | BioModels
Project description:Contaminated aquifer (Dusseldorf-Flinger, Germany) templates extracted from 5 sediment depths ranging between 6.4 and 8.4 m below ground and over 3 years of sampling were amplified for amplicon pyrosequencing using the primers Ba27f (5’-aga gtt tga tcm tgg ctc ag-3’) and Ba519r (5’- tat tac cgc ggc kgc tg-3’), extended as amplicon fusion primers with respective primer A or B adapters, key sequence and multiplex identifiers (MID) as recommended by 454/Roche. Amplicons were purified and pooled as specified by the manufacturer. Emulsion PCR (emPCR), purification of DNA-enriched beads and sequencing run were performed following protocols and using a 2nd generation pyrosequencer (454 GS FLX Titanium, Roche) as recommended by the developer. Quality filtering of the pyrosequencing reads was performed using the automatic amplicon pipeline of the GS Run Processor (Roche), with a slight modification concerning the valley filter (vfScanAllFlows false instead of TiOnly) to extract the sequences. Demultiplexed raw reads were furhter trimmed for quality and lenght (>250 bp). 15 samples examined in total from important plume zones of the aquifer sampled in Feb. 2006, Sep. 2008 and Jun. 2009 (5 every year of sampling).
2012-11-11 | E-GEOD-25345 | biostudies-arrayexpress
Project description:Genome editing was conducted on a t(3;8) K562 model to investigate the effects of deleting different modules or CTCF binding sites within the MYC super-enhancer. To check mutations after targeting with CRISPR-Cas9 we performed amplicon sequencing using the Illumina PCR-based custom amplicon sequencing method using the TruSeq Custom Amplicon index kit (Illumina). The first PCR was performed using Q5 polymerase (NEB), the second nested PCR with KAPA HiFi HotStart Ready mix (Roche). Samples were sequenced paired-end (2x 250bp) on a MiSeq (Illumina).
2021-07-26 | E-MTAB-9937 | biostudies-arrayexpress
Project description:RNA sequencing of human neonatal Naive CD4+ T cells and adult Naive CD4+ T cells treated with Scr or LINE1 ASO to assess functional relevance of LINE1 absence in newborns.
2024-08-30 | E-MTAB-13718 | biostudies-arrayexpress
Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
2022-01-26 | GSE125786 | GEO
Project description:Following a CRISPR enhancer scan covering the GATA2 super-enhancer region, the top sgRNAs were selected for further inspection. MUTZ3 cells were thus treated with the selected sgRNAs and the region of interested was subjected to amplicons sequencing (amplicon-seq). To that end, we used the Illumina PCR-based custom amplicon sequencing method using the TruSeq Custom Amplicon index kit (Illumina). The same experiment was conducted in K562 cells, which do not harbor an inv(3)/t(3;3), to investigate the role of MYB in this enhancer in other leukemia settings
2021-07-26 | E-MTAB-9945 | biostudies-arrayexpress
Project description:Microbiome PCR primer model is a Named Entity Recognition (NER) model that identifies and annotates microbiome target gene primers in texts. This is the final model version used to annotate metagenomics publications in Europe PMC and enrich metagenomics studies in MGnify with primer metadata from literature. For more information, please refer to the following blogs: http://blog.europepmc.org/2020/11/europe-pmc-publications-metagenomics-annotations.html https://www.ebi.ac.uk/about/news/service-news/enriched-metadata-fields-mgnify-based-text-mining-associated-publications
2022-02-21 | MODEL2202170011 | BioModels
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO