Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1245055 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:This is an in vitro genome-wide CRISPR/cas9 screen in human glioblastoma stem cells, screening for genes essential for survival of these cells. These cells express cas9 and have been transfected with a guide RNA library causing gene knockouts. We will analyse the sequencing data for depletion of guide RNAs. In this particular study, we will do RNA sequencing to correlate CRISPR with expression levels in specific cancer cell subpopulations. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/
2016-03-22 | E-ERAD-448 | biostudies-arrayexpress
Project description:A CRISPR/Cas9 library screening identified CARM1 as a critical inhibitor for Sorafenib-induced ferroptosis in hepatocellular carcinoma cells [CRISPR screen]
| PRJNA891260 | ENA
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:A CRISPR/Cas9 library screening identified CARM1 as a critical inhibitor for Sorafenib-induced ferroptosis in hepatocellular carcinoma cells
| PRJNA889443 | ENA
Project description:CRISPR/Cas9 genome editing was used to disrupt nearly all the GPCR and neuropeptide genes from C. elegans genome. Multiple genes were disrupted in each strain for the purpose of screening. The genotype is the list of targeted genes
2023-06-02 | E-MTAB-12983 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Purpose: Modeling microenvironmental influences in cell culture has been challenging, and technical limitations have hampered the comprehensive study of tumor-specific metabolism in vivo. To systematically interrogate metabolic vulnerabilities in PDA, we employed parallel CRISPR-Cas9 genetic screens using both in vivo and in vitro model systems. Methods: A custom library of lentiviral vectors encoding ~18,000 sgRNAs targeting ~3,000 mouse metabolic genes and performed CRISPR-Cas9 screens using a C/57BL6 (B6) mouse pancreatic cancer cell line derived from a KrasG12D-driven autochthonous PDA model. After transduction and selection, parallel screens were performed by in vitro passage or tumor implantation subcutaneously into the flanks of syngeneic hosts. Genomic DNA was then harvaested in vitro after 7 passages (21 days in culture) and in vivo 21 days after implantation. Results: This work revealed striking overlap of in vivo metabolic dependencies with those in vitro, validating that standard 2D culture conditions are a reliable system for studying cancer metabolism. Moreover, we identified that intercellular nutrient sharing can mask cancer dependencies in pooled screening experiments, highlighting an important limitation of this approach to study tumor metabolism Conclusions:Our work demonstrates the power of genetic screening approaches to define the compendium of in vivo metabolic dependencies in PDA and highlights critical metabolic pathways that may have therapeutic utility.
2020-10-01 | GSE158789 | GEO
Project description:Tumor Infiltrating Lymphocyte (TIL) therapy have shown promise in the treatment of patients with refractory solid tumors, with improvement in response rates and durability of responses nevertheless sought. To identify targets capable of enhancing the anti-tumor activity of T cell therapies, large-scale in vitro and in vivo CRISPR/Cas9 screens were performed, with the suppressor of cytokine signaling 1 (SOCS1) gene identified as a top T cell-enhancing target. In murine CD8 T cell therapy models, SOCS1 served as a critical checkpoint in restraining the accumulation of T central memory cells in lymphoid organs as well as intermediate (Texint) and effector (Texeff) exhausted T cell subsets derived from progenitor exhausted T cell (Texprog) cells in tumors. A comprehensive CRISPR tiling screen of the SOCS1 coding region identified sgRNAs targeting the SH2 domain of SOCS1 as the most potent, with a sgRNA with minimal off-target cut sites used to manufacture KSQ-001, an engineered TIL therapy with SOCS1 inactivated by CRISPR/Cas9. KSQ-001 possessed increased responsiveness to cytokine signals and enhanced in vivo anti-tumor function in mouse models. These data demonstrate the use of CRISPR/Cas9 screens in the rational design of T cell therapies.
2023-07-30 | GSE237694 | GEO